WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
>TruSeq2_PE_r
AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG

Read1 before filtering:
total reads: 7207073
total bases: 1037818512
Q20 bases: 1001826658(96.532%)
Q30 bases: 942378265(90.8038%)

Read1 after filtering:
total reads: 7124258
total bases: 1021768540
Q20 bases: 991819497(97.0689%)
Q30 bases: 934419541(91.4512%)

Filtering result:
reads passed filter: 7124258
reads failed due to low quality: 14584
reads failed due to too many N: 9874
reads failed due to too short: 58357
reads with adapter trimmed: 109510
bases trimmed due to adapters: 11761279

Duplication rate (may be overestimated since this is SE data): 65.8413%

JSON report: PortGambleWA_FG190.json
HTML report: PortGambleWA_FG190.html

fastp -i PortGambleWA_FG190.F.fq.gz -o PortGambleWA_FG190.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j PortGambleWA_FG190.json -h PortGambleWA_FG190.html 
fastp v0.20.0, time used: 65 seconds