WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AAACTCATCACGAACGTCAGAAGCAGCCTTATGGCCGTCAACATACATATCACCATTATC

Read1 before filtering:
total reads: 3638209
total bases: 523902096
Q20 bases: 507642250(96.8964%)
Q30 bases: 486076596(92.78%)

Read1 after filtering:
total reads: 3594616
total bases: 517560799
Q20 bases: 502030857(96.9994%)
Q30 bases: 480931571(92.9227%)

Filtering result:
reads passed filter: 3594616
reads failed due to low quality: 6500
reads failed due to too many N: 2208
reads failed due to too short: 34885
reads with adapter trimmed: 44522
bases trimmed due to adapters: 3937722

Duplication rate (may be overestimated since this is SE data): 67.8731%

JSON report: PortGambleWA_FG189.json
HTML report: PortGambleWA_FG189.html

fastp -i PortGambleWA_FG189.F.fq.gz -o PortGambleWA_FG189.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j PortGambleWA_FG189.json -h PortGambleWA_FG189.html 
fastp v0.20.0, time used: 33 seconds