WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAG

Read1 before filtering:
total reads: 2902379
total bases: 417942576
Q20 bases: 406435975(97.2468%)
Q30 bases: 390513531(93.4371%)

Read1 after filtering:
total reads: 2878384
total bases: 414422115
Q20 bases: 403347977(97.3278%)
Q30 bases: 387657956(93.5418%)

Filtering result:
reads passed filter: 2878384
reads failed due to low quality: 4306
reads failed due to too many N: 1672
reads failed due to too short: 18017
reads with adapter trimmed: 27484
bases trimmed due to adapters: 2658082

Duplication rate (may be overestimated since this is SE data): 74.5096%

JSON report: DabobBayWA_Q358.json
HTML report: DabobBayWA_Q358.html

fastp -i DabobBayWA_Q358.F.fq.gz -o DabobBayWA_Q358.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_Q358.json -h DabobBayWA_Q358.html 
fastp v0.20.0, time used: 29 seconds