WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ATAGTTGTTATAGATATTCAAATAACCCTGAAACAAATGCTTAGGGATTTTATTGGTATC

Read1 before filtering:
total reads: 2822532
total bases: 406444608
Q20 bases: 395407763(97.2845%)
Q30 bases: 379822415(93.45%)

Read1 after filtering:
total reads: 2789402
total bases: 401630733
Q20 bases: 391009121(97.3554%)
Q30 bases: 375669988(93.5362%)

Filtering result:
reads passed filter: 2789402
reads failed due to low quality: 3968
reads failed due to too many N: 1539
reads failed due to too short: 27623
reads with adapter trimmed: 33577
bases trimmed due to adapters: 4018801

Duplication rate (may be overestimated since this is SE data): 72.9146%

JSON report: DabobBayWA_Q243.json
HTML report: DabobBayWA_Q243.html

fastp -i DabobBayWA_Q243.F.fq.gz -o DabobBayWA_Q243.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_Q243.json -h DabobBayWA_Q243.html 
fastp v0.20.0, time used: 27 seconds