WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GTTTTATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCT

Read1 before filtering:
total reads: 2342278
total bases: 337288032
Q20 bases: 327889822(97.2136%)
Q30 bases: 314921420(93.3687%)

Read1 after filtering:
total reads: 2326070
total bases: 334253702
Q20 bases: 325231502(97.3008%)
Q30 bases: 312498151(93.4913%)

Filtering result:
reads passed filter: 2326070
reads failed due to low quality: 3397
reads failed due to too many N: 1353
reads failed due to too short: 11458
reads with adapter trimmed: 50127
bases trimmed due to adapters: 2348984

Duplication rate (may be overestimated since this is SE data): 74.0322%

JSON report: DabobBayWA_Q237.json
HTML report: DabobBayWA_Q237.html

fastp -i DabobBayWA_Q237.F.fq.gz -o DabobBayWA_Q237.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_Q237.json -h DabobBayWA_Q237.html 
fastp v0.20.0, time used: 24 seconds