WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CAGGGTTAGGAACATTAGAGCCTTGAATGGCAGATTTAATACCAGCATCACCCATGCCTA

Read1 before filtering:
total reads: 2946534
total bases: 424300896
Q20 bases: 412057258(97.1144%)
Q30 bases: 395282421(93.1609%)

Read1 after filtering:
total reads: 2927732
total bases: 421565538
Q20 bases: 409786469(97.2059%)
Q30 bases: 393230642(93.2786%)

Filtering result:
reads passed filter: 2927732
reads failed due to low quality: 4883
reads failed due to too many N: 1788
reads failed due to too short: 12131
reads with adapter trimmed: 15964
bases trimmed due to adapters: 1773073

Duplication rate (may be overestimated since this is SE data): 71.7175%

JSON report: DabobBayWA_Q236.json
HTML report: DabobBayWA_Q236.html

fastp -i DabobBayWA_Q236.F.fq.gz -o DabobBayWA_Q236.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_Q236.json -h DabobBayWA_Q236.html 
fastp v0.20.0, time used: 31 seconds