WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GGAAGTAGCGACAGCTTGGTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGACCTTTA

Read1 before filtering:
total reads: 3125942
total bases: 450135648
Q20 bases: 436537994(96.9792%)
Q30 bases: 418737374(93.0247%)

Read1 after filtering:
total reads: 3107593
total bases: 447460207
Q20 bases: 434331418(97.0659%)
Q30 bases: 416749137(93.1366%)

Filtering result:
reads passed filter: 3107593
reads failed due to low quality: 4838
reads failed due to too many N: 1988
reads failed due to too short: 11523
reads with adapter trimmed: 16743
bases trimmed due to adapters: 1690764

Duplication rate (may be overestimated since this is SE data): 73.9494%

JSON report: DabobBayWA_Q234.json
HTML report: DabobBayWA_Q234.html

fastp -i DabobBayWA_Q234.F.fq.gz -o DabobBayWA_Q234.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_Q234.json -h DabobBayWA_Q234.html 
fastp v0.20.0, time used: 34 seconds