WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AAGTTAGACCAAACCATGAAACCAACATAAACATTATTGCCCGGCGTACGGGGAAGGACG

Read1 before filtering:
total reads: 3670550
total bases: 528559200
Q20 bases: 513799273(97.2075%)
Q30 bases: 493432452(93.3542%)

Read1 after filtering:
total reads: 3653956
total bases: 526094351
Q20 bases: 511848565(97.2922%)
Q30 bases: 491715747(93.4653%)

Filtering result:
reads passed filter: 3653956
reads failed due to low quality: 5444
reads failed due to too many N: 2204
reads failed due to too short: 8946
reads with adapter trimmed: 20967
bases trimmed due to adapters: 1361960

Duplication rate (may be overestimated since this is SE data): 72.6539%

JSON report: DabobBayWA_Q232.json
HTML report: DabobBayWA_Q232.html

fastp -i DabobBayWA_Q232.F.fq.gz -o DabobBayWA_Q232.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_Q232.json -h DabobBayWA_Q232.html 
fastp v0.20.0, time used: 36 seconds