WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AAGAACGTCAGTGTTTCCTGCGCGTACACGCAAGGTAAACGCGAACAATTCAGCGGCTTT

Read1 before filtering:
total reads: 2402570
total bases: 345970080
Q20 bases: 336476421(97.2559%)
Q30 bases: 323444593(93.4892%)

Read1 after filtering:
total reads: 2367764
total bases: 338873328
Q20 bases: 329849826(97.3372%)
Q30 bases: 317198451(93.6038%)

Filtering result:
reads passed filter: 2367764
reads failed due to low quality: 3420
reads failed due to too many N: 1448
reads failed due to too short: 29938
reads with adapter trimmed: 53716
bases trimmed due to adapters: 5481951

Duplication rate (may be overestimated since this is SE data): 70.7425%

JSON report: DabobBayWA_FG249.json
HTML report: DabobBayWA_FG249.html

fastp -i DabobBayWA_FG249.F.fq.gz -o DabobBayWA_FG249.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG249.json -h DabobBayWA_FG249.html 
fastp v0.20.0, time used: 22 seconds