WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCG

Read1 before filtering:
total reads: 3524531
total bases: 507532464
Q20 bases: 492399852(97.0184%)
Q30 bases: 471908963(92.981%)

Read1 after filtering:
total reads: 3498724
total bases: 503777727
Q20 bases: 489245923(97.1154%)
Q30 bases: 469059174(93.1084%)

Filtering result:
reads passed filter: 3498724
reads failed due to low quality: 6164
reads failed due to too many N: 2059
reads failed due to too short: 17584
reads with adapter trimmed: 23000
bases trimmed due to adapters: 1385947

Duplication rate (may be overestimated since this is SE data): 67.9244%

JSON report: DabobBayWA_FG229.json
HTML report: DabobBayWA_FG229.html

fastp -i DabobBayWA_FG229.F.fq.gz -o DabobBayWA_FG229.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG229.json -h DabobBayWA_FG229.html 
fastp v0.20.0, time used: 37 seconds