WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAAC

Read1 before filtering:
total reads: 3487630
total bases: 502218720
Q20 bases: 486501166(96.8704%)
Q30 bases: 466695486(92.9267%)

Read1 after filtering:
total reads: 3450646
total bases: 496756901
Q20 bases: 483317741(97.2946%)
Q30 bases: 464251377(93.4565%)

Filtering result:
reads passed filter: 3450646
reads failed due to low quality: 24181
reads failed due to too many N: 1995
reads failed due to too short: 10808
reads with adapter trimmed: 20270
bases trimmed due to adapters: 1690623

Duplication rate (may be overestimated since this is SE data): 67.6439%

JSON report: DabobBayWA_FG227.json
HTML report: DabobBayWA_FG227.html

fastp -i DabobBayWA_FG227.F.fq.gz -o DabobBayWA_FG227.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG227.json -h DabobBayWA_FG227.html 
fastp v0.20.0, time used: 36 seconds