WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
TGCGTGTAGCGAACTGCGATGGGCATACTGTAACCATAAGGCCACGTATTTTGCAAGCTA

Read1 before filtering:
total reads: 2354208
total bases: 339005952
Q20 bases: 329352760(97.1525%)
Q30 bases: 316115604(93.2478%)

Read1 after filtering:
total reads: 2344417
total bases: 337579794
Q20 bases: 328294411(97.2494%)
Q30 bases: 315211892(93.374%)

Filtering result:
reads passed filter: 2344417
reads failed due to low quality: 4062
reads failed due to too many N: 1406
reads failed due to too short: 4323
reads with adapter trimmed: 6502
bases trimmed due to adapters: 637739

Duplication rate (may be overestimated since this is SE data): 69.7855%

JSON report: DabobBayWA_FG226.json
HTML report: DabobBayWA_FG226.html

fastp -i DabobBayWA_FG226.F.fq.gz -o DabobBayWA_FG226.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG226.json -h DabobBayWA_FG226.html 
fastp v0.20.0, time used: 24 seconds