WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AGGACGTCAATAGTCACACAGTCCTTGACGGTATAATAACCACCATCATGGCGACCATCC

Read1 before filtering:
total reads: 3418534
total bases: 492268896
Q20 bases: 478597258(97.2227%)
Q30 bases: 459966097(93.438%)

Read1 after filtering:
total reads: 3386358
total bases: 486866521
Q20 bases: 474228409(97.4042%)
Q30 bases: 455968486(93.6537%)

Filtering result:
reads passed filter: 3386358
reads failed due to low quality: 8739
reads failed due to too many N: 4649
reads failed due to too short: 18788
reads with adapter trimmed: 47172
bases trimmed due to adapters: 3462904

Duplication rate (may be overestimated since this is SE data): 68.2002%

JSON report: DabobBayWA_FG211.json
HTML report: DabobBayWA_FG211.html

fastp -i DabobBayWA_FG211.F.fq.gz -o DabobBayWA_FG211.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG211.json -h DabobBayWA_FG211.html 
fastp v0.20.0, time used: 32 seconds