WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GGTTAATCGTGCCAAGAAAAGCGGCATGGTCAATATAACCAGTAGTGTTAACAGTCGGGA

Read1 before filtering:
total reads: 4300589
total bases: 619284816
Q20 bases: 601521528(97.1316%)
Q30 bases: 577284171(93.2179%)

Read1 after filtering:
total reads: 4259934
total bases: 613392739
Q20 bases: 596951995(97.3197%)
Q30 bases: 573123379(93.435%)

Filtering result:
reads passed filter: 4259934
reads failed due to low quality: 11635
reads failed due to too many N: 5799
reads failed due to too short: 23221
reads with adapter trimmed: 27217
bases trimmed due to adapters: 3377948

Duplication rate (may be overestimated since this is SE data): 60.5445%

JSON report: DabobBayWA_FG210.json
HTML report: DabobBayWA_FG210.html

fastp -i DabobBayWA_FG210.F.fq.gz -o DabobBayWA_FG210.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG210.json -h DabobBayWA_FG210.html 
fastp v0.20.0, time used: 45 seconds