WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAA

Read1 before filtering:
total reads: 3781332
total bases: 544511808
Q20 bases: 529173672(97.1831%)
Q30 bases: 508173052(93.3264%)

Read1 after filtering:
total reads: 3756544
total bases: 540821125
Q20 bases: 526593222(97.3692%)
Q30 bases: 505909861(93.5448%)

Filtering result:
reads passed filter: 3756544
reads failed due to low quality: 9802
reads failed due to too many N: 5132
reads failed due to too short: 9854
reads with adapter trimmed: 24115
bases trimmed due to adapters: 1537271

Duplication rate (may be overestimated since this is SE data): 64.5676%

JSON report: DabobBayWA_FG209.json
HTML report: DabobBayWA_FG209.html

fastp -i DabobBayWA_FG209.F.fq.gz -o DabobBayWA_FG209.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG209.json -h DabobBayWA_FG209.html 
fastp v0.20.0, time used: 38 seconds