WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
TTTAGCTCCTAGACCTTTAGCAGCAAGGTCCATATCTGACTTTTTGTTAACGTATTTAGC

Read1 before filtering:
total reads: 5033643
total bases: 724844592
Q20 bases: 704183741(97.1496%)
Q30 bases: 676307493(93.3038%)

Read1 after filtering:
total reads: 5001526
total bases: 719863132
Q20 bases: 700756706(97.3458%)
Q30 bases: 673318807(93.5343%)

Filtering result:
reads passed filter: 5001526
reads failed due to low quality: 14158
reads failed due to too many N: 6934
reads failed due to too short: 11025
reads with adapter trimmed: 26330
bases trimmed due to adapters: 1940665

Duplication rate (may be overestimated since this is SE data): 65.8428%

JSON report: DabobBayWA_FG205.json
HTML report: DabobBayWA_FG205.html

fastp -i DabobBayWA_FG205.F.fq.gz -o DabobBayWA_FG205.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG205.json -h DabobBayWA_FG205.html 
fastp v0.20.0, time used: 47 seconds