WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GCGGTAAAGTTAGACCAAACCATGAAACCAACATAAACATTATTGCCCGGCGTACGGGGA

Read1 before filtering:
total reads: 5472398
total bases: 788025312
Q20 bases: 765048490(97.0843%)
Q30 bases: 733828088(93.1224%)

Read1 after filtering:
total reads: 5435668
total bases: 781796402
Q20 bases: 760493528(97.2751%)
Q30 bases: 729780783(93.3467%)

Filtering result:
reads passed filter: 5435668
reads failed due to low quality: 14908
reads failed due to too many N: 7365
reads failed due to too short: 14457
reads with adapter trimmed: 37266
bases trimmed due to adapters: 3017785

Duplication rate (may be overestimated since this is SE data): 61.648%

JSON report: DabobBayWA_FG203.json
HTML report: DabobBayWA_FG203.html

fastp -i DabobBayWA_FG203.F.fq.gz -o DabobBayWA_FG203.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG203.json -h DabobBayWA_FG203.html 
fastp v0.20.0, time used: 52 seconds