WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
CTTAAACTTCTTAGACGAATCACCAGAACGGAAAACATCCTTCATAGAAATTTCACGCGG

Read1 before filtering:
total reads: 4039122
total bases: 581633568
Q20 bases: 565315894(97.1945%)
Q30 bases: 542788746(93.3214%)

Read1 after filtering:
total reads: 4007665
total bases: 576193994
Q20 bases: 561065176(97.3744%)
Q30 bases: 538933145(93.5333%)

Filtering result:
reads passed filter: 4007665
reads failed due to low quality: 10087
reads failed due to too many N: 5319
reads failed due to too short: 16051
reads with adapter trimmed: 37011
bases trimmed due to adapters: 3216879

Duplication rate (may be overestimated since this is SE data): 65.7491%

JSON report: DabobBayWA_FG201.json
HTML report: DabobBayWA_FG201.html

fastp -i DabobBayWA_FG201.F.fq.gz -o DabobBayWA_FG201.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j DabobBayWA_FG201.json -h DabobBayWA_FG201.html 
fastp v0.20.0, time used: 38 seconds