WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GTTAGACCAAACCATGAAACCAACATAAACATTATTGCCCGGCGTACGGGGAAGGACGTC

Read1 before filtering:
total reads: 3155931
total bases: 454454064
Q20 bases: 441215886(97.087%)
Q30 bases: 423367357(93.1595%)

Read1 after filtering:
total reads: 3122154
total bases: 449568269
Q20 bases: 436879342(97.1775%)
Q30 bases: 419343757(93.277%)

Filtering result:
reads passed filter: 3122154
reads failed due to low quality: 5298
reads failed due to too many N: 1834
reads failed due to too short: 26645
reads with adapter trimmed: 29713
bases trimmed due to adapters: 3857019

Duplication rate (may be overestimated since this is SE data): 72.5232%

JSON report: CypressIslandWA_FG140.json
HTML report: CypressIslandWA_FG140.html

fastp -i CypressIslandWA_FG140.F.fq.gz -o CypressIslandWA_FG140.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j CypressIslandWA_FG140.json -h CypressIslandWA_FG140.html 
fastp v0.20.0, time used: 31 seconds