WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
TATAGGTCTGTTGAACACGACCAGAAAACTGGCCTAACGACGTTTGGTCAGTTCCATCAA

Read1 before filtering:
total reads: 2871849
total bases: 413546256
Q20 bases: 402064918(97.2237%)
Q30 bases: 385998220(93.3386%)

Read1 after filtering:
total reads: 2846400
total bases: 408937754
Q20 bases: 397898532(97.3005%)
Q30 bases: 382104084(93.4382%)

Filtering result:
reads passed filter: 2846400
reads failed due to low quality: 4138
reads failed due to too many N: 1629
reads failed due to too short: 19682
reads with adapter trimmed: 44526
bases trimmed due to adapters: 3775871

Duplication rate (may be overestimated since this is SE data): 72.2783%

JSON report: CypressIslandWA_FG136.json
HTML report: CypressIslandWA_FG136.html

fastp -i CypressIslandWA_FG136.F.fq.gz -o CypressIslandWA_FG136.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j CypressIslandWA_FG136.json -h CypressIslandWA_FG136.html 
fastp v0.20.0, time used: 26 seconds