WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
ATCCGCGGCATTTAGTAGCGGTAAAGTTAGACCAAACCATGAAACCAACATAAACATTAT

Read1 before filtering:
total reads: 3669621
total bases: 528425424
Q20 bases: 513742695(97.2214%)
Q30 bases: 493292383(93.3514%)

Read1 after filtering:
total reads: 3642020
total bases: 522922475
Q20 bases: 508859934(97.3108%)
Q30 bases: 488770762(93.4691%)

Filtering result:
reads passed filter: 3642020
reads failed due to low quality: 5875
reads failed due to too many N: 2254
reads failed due to too short: 19472
reads with adapter trimmed: 46253
bases trimmed due to adapters: 4330278

Duplication rate (may be overestimated since this is SE data): 66.1028%

JSON report: CypressIslandWA_FG123.json
HTML report: CypressIslandWA_FG123.html

fastp -i CypressIslandWA_FG123.F.fq.gz -o CypressIslandWA_FG123.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j CypressIslandWA_FG123.json -h CypressIslandWA_FG123.html 
fastp v0.20.0, time used: 38 seconds