WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
GCAAGAGTAAACATAGTGCCATGCTCAGGAACAAAGAAACGCGGCACAGAATGTTTATAG

Read1 before filtering:
total reads: 2698131
total bases: 388530864
Q20 bases: 377816330(97.2423%)
Q30 bases: 363002932(93.4296%)

Read1 after filtering:
total reads: 2676450
total bases: 384615106
Q20 bases: 374297360(97.3174%)
Q30 bases: 359716216(93.5263%)

Filtering result:
reads passed filter: 2676450
reads failed due to low quality: 3770
reads failed due to too many N: 1525
reads failed due to too short: 16386
reads with adapter trimmed: 35810
bases trimmed due to adapters: 3151449

Duplication rate (may be overestimated since this is SE data): 58.6599%

JSON report: CypressIslandWA_FG118.json
HTML report: CypressIslandWA_FG118.html

fastp -i CypressIslandWA_FG118.F.fq.gz -o CypressIslandWA_FG118.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j CypressIslandWA_FG118.json -h CypressIslandWA_FG118.html 
fastp v0.20.0, time used: 25 seconds