WARNING: cut_by_quality5 is deprecated, please use cut_front instead. Detecting adapter sequence for read1... CCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGAC Read1 before filtering: total reads: 1749372 total bases: 251909568 Q20 bases: 244562042(97.0833%) Q30 bases: 234640361(93.1447%) Read1 after filtering: total reads: 1713978 total bases: 246804126 Q20 bases: 239812386(97.1671%) Q30 bases: 230161712(93.2568%) Filtering result: reads passed filter: 1713978 reads failed due to low quality: 2875 reads failed due to too many N: 1032 reads failed due to too short: 31487 reads with adapter trimmed: 32277 bases trimmed due to adapters: 4541310 Duplication rate (may be overestimated since this is SE data): 69.7856% JSON report: CypressIslandWA_FG113.json HTML report: CypressIslandWA_FG113.html fastp -i CypressIslandWA_FG113.F.fq.gz -o CypressIslandWA_FG113.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j CypressIslandWA_FG113.json -h CypressIslandWA_FG113.html fastp v0.20.0, time used: 20 seconds