WARNING: cut_by_quality5 is deprecated, please use cut_front instead.
Detecting adapter sequence for read1...
AAGAACGTCAGTGTTTCCTGCGCGTACACGCAAGGTAAACGCGAACAATTCAGCGGCTTT

Read1 before filtering:
total reads: 3599537
total bases: 518333328
Q20 bases: 502741459(96.9919%)
Q30 bases: 482524791(93.0916%)

Read1 after filtering:
total reads: 3556674
total bases: 510249068
Q20 bases: 495883741(97.1846%)
Q30 bases: 476162145(93.3196%)

Filtering result:
reads passed filter: 3556674
reads failed due to low quality: 10251
reads failed due to too many N: 4754
reads failed due to too short: 27858
reads with adapter trimmed: 53612
bases trimmed due to adapters: 5074456

Duplication rate (may be overestimated since this is SE data): 69.8473%

JSON report: CypressIslandWA_FG109.json
HTML report: CypressIslandWA_FG109.html

fastp -i CypressIslandWA_FG109.F.fq.gz -o CypressIslandWA_FG109.R1.fq.gz --cut_by_quality5 20 --cut_by_quality3 20 --cut_window_size 5 --cut_mean_quality 15 -q 15 -u 50 -j CypressIslandWA_FG109.json -h CypressIslandWA_FG109.html 
fastp v0.20.0, time used: 33 seconds