Path to genome folder specified as: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ Using 28 threads for the top and bottom strand indexing processes each, so using 56 cores in total Aligner to be used: >> Bowtie 2 << (default) Writing bisulfite genomes out into a single MFA (multi FastA) file Bismark Genome Preparation - Step I: Preparing folders Path to Bowtie 2 specified as: /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ Bisulfite Genome Indexer version v0.21.0 (last modified: 05 Feb 2019) Created Bisulfite Genome folder /gscratch/srlab/sr320/data/dumoar/scaff-genome/Bisulfite_Genome/ Created Bisulfite Genome folder /gscratch/srlab/sr320/data/dumoar/scaff-genome/Bisulfite_Genome/CT_conversion/ Created Bisulfite Genome folder /gscratch/srlab/sr320/data/dumoar/scaff-genome/Bisulfite_Genome/GA_conversion/ Step I - Prepare genome folders - completed Bismark Genome Preparation - Step II: Bisulfite converting reference genome conversions performed: chromosome C->T G->A PGA_scaffold0__40_contigs__length_4818635 955093 916552 PGA_scaffold1__111_contigs__length_23635802 4696228 4744183 PGA_scaffold2__216_contigs__length_42616187 8365956 8286312 PGA_scaffold3__77_contigs__length_22140449 4547160 4532974 PGA_scaffold4__118_contigs__length_24133938 4876125 4834294 PGA_scaffold5__54_contigs__length_17529967 3561360 3569070 PGA_scaffold6__2_contigs__length_4500 713 533 PGA_scaffold7__77_contigs__length_16129408 3367042 3365927 PGA_scaffold8__70_contigs__length_6254265 1210172 1218300 PGA_scaffold9__2_contigs__length_6774 1604 1488 PGA_scaffold10__58_contigs__length_8083807 1631825 1633444 PGA_scaffold11__78_contigs__length_11409253 2279663 2289479 PGA_scaffold12__214_contigs__length_38711105 7685313 7616568 PGA_scaffold13__56_contigs__length_10281103 2034144 2012303 PGA_scaffold14__49_contigs__length_6382615 1263323 1287310 PGA_scaffold15__74_contigs__length_14466968 2959602 2977108 PGA_scaffold16__99_contigs__length_13714835 2773137 2783430 PGA_scaffold17__171_contigs__length_27881435 5614765 5674175 PGA_scaffold18__98_contigs__length_15388888 3093829 3139608 PGA_scaffold19__65_contigs__length_13296201 2683867 2742261 PGA_scaffold20__42_contigs__length_7444180 1494076 1477831 PGA_scaffold21__67_contigs__length_16858916 3452472 3439432 PGA_scaffold22__59_contigs__length_10008237 2040161 2034324 PGA_scaffold23__65_contigs__length_9586800 1922445 1920255 PGA_scaffold24__25_contigs__length_9615596 1991287 1957329 PGA_scaffold25__121_contigs__length_9021638 1782860 1770950 PGA_scaffold26__34_contigs__length_3174094 583842 597525 PGA_scaffold27__24_contigs__length_4511419 920618 928666 PGA_scaffold28__73_contigs__length_10794191 2151699 2161942 PGA_scaffold29__63_contigs__length_7458616 1492004 1506902 PGA_scaffold30__53_contigs__length_3533588 700347 717225 PGA_scaffold31__35_contigs__length_1951197 382263 381550 PGA_scaffold32__48_contigs__length_8091588 1624329 1648757 PGA_scaffold33__68_contigs__length_5591008 1131028 1119427 PGA_scaffold34__18_contigs__length_2048619 393847 397326 PGA_scaffold35__36_contigs__length_7416912 1491552 1487018 PGA_scaffold36__50_contigs__length_8312113 1661621 1678373 PGA_scaffold37__114_contigs__length_22981779 4648073 4686293 PGA_scaffold38__30_contigs__length_10707134 2162677 2181190 PGA_scaffold39__82_contigs__length_19157343 3903009 3885371 PGA_scaffold40__81_contigs__length_9975379 2009829 1990627 PGA_scaffold41__67_contigs__length_15779270 3237577 3234511 PGA_scaffold42__119_contigs__length_25812110 5272454 5240685 PGA_scaffold43__161_contigs__length_26349757 5376722 5354858 PGA_scaffold44__101_contigs__length_25971783 5250055 5315264 PGA_scaffold45__51_contigs__length_13476971 2701147 2700589 PGA_scaffold46__73_contigs__length_12693875 2571596 2578090 PGA_scaffold47__164_contigs__length_21858264 4440028 4428866 PGA_scaffold48__117_contigs__length_14149252 2909039 2914334 Total number of conversions performed: C->T: 133299578 G->A: 133360829 Step II - Genome bisulfite conversions - completed Bismark Genome Preparation - Step III: Launching the Bowtie 2 indexer Please be aware that this process can - depending on genome size - take several hours! Preparing indexing of CT converted genome in /gscratch/srlab/sr320/data/dumoar/scaff-genome/Bisulfite_Genome/CT_conversion/ Parent process: Starting to index C->T converted genome with the following command: /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/bowtie2-build -f genome_mfa.CT_conversion.fa BS_CT --threads 28 Settings: Output files: "BS_CT.*.bt2" Line rate: 6 (line is 64 bytes) Lines per side: 1 (side is 64 bytes) Offset rate: 4 (one in 16) FTable chars: 10 Strings: unpacked Max bucket size: default Max bucket size, sqrt multiplier: default Max bucket size, len divisor: 112 Difference-cover sample period: 1024 Endianness: little Actual local endianness: little Sanity checking: disabled Assertions: disabled Random seed: 0 Sizeofs: void*:8, int:4, long:8, size_t:8 Input files DNA, FASTA: genome_mfa.CT_conversion.fa Building a SMALL index Reading reference sizes Preparing indexing of GA converted genome in /gscratch/srlab/sr320/data/dumoar/scaff-genome/Bisulfite_Genome/GA_conversion/ Child process: Starting to index G->A converted genome with the following command: /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/bowtie2-build -f genome_mfa.GA_conversion.fa BS_GA --threads 28 Settings: Output files: "BS_GA.*.bt2" Line rate: 6 (line is 64 bytes) Lines per side: 1 (side is 64 bytes) Offset rate: 4 (one in 16) FTable chars: 10 Strings: unpacked Max bucket size: default Max bucket size, sqrt multiplier: default Max bucket size, len divisor: 112 Difference-cover sample period: 1024 Endianness: little Actual local endianness: little Sanity checking: disabled Assertions: disabled Random seed: 0 Sizeofs: void*:8, int:4, long:8, size_t:8 Input files DNA, FASTA: genome_mfa.GA_conversion.fa Building a SMALL index Reading reference sizes Time reading reference sizes: 00:00:05 Calculating joined length Writing header Reserving space for joined string Joining reference sequences Time reading reference sizes: 00:00:06 Calculating joined length Writing header Reserving space for joined string Joining reference sequences Time to join reference sequences: 00:00:03 bmax according to bmaxDivN setting: 5900355 Using parameters --bmax 4425267 --dcv 1024 Doing ahead-of-time memory usage test Passed! Constructing with these parameters: --bmax 4425267 --dcv 1024 Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime Building sPrimeOrder V-Sorting samples Time to join reference sequences: 00:00:03 bmax according to bmaxDivN setting: 5900355 Using parameters --bmax 4425267 --dcv 1024 Doing ahead-of-time memory usage test Passed! Constructing with these parameters: --bmax 4425267 --dcv 1024 Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime Building sPrimeOrder V-Sorting samples V-Sorting samples time: 00:00:07 Allocating rank array Ranking v-sort output V-Sorting samples time: 00:00:06 Allocating rank array Ranking v-sort output Ranking v-sort output time: 00:00:04 Invoking Larsson-Sadakane on ranks Ranking v-sort output time: 00:00:04 Invoking Larsson-Sadakane on ranks Invoking Larsson-Sadakane on ranks time: 00:00:05 Sanity-checking and returning Building samples Reserving space for 300 sample suffixes Generating random suffixes QSorting 300 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 300 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes Invoking Larsson-Sadakane on ranks time: 00:00:05 Sanity-checking and returning Building samples Reserving space for 300 sample suffixes Generating random suffixes QSorting 300 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 300 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes Splitting and merging Splitting and merging time: 00:00:00 Split 39, merged 137; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 41, merged 127; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 20, merged 15; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 15, merged 18; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 11, merged 18; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 10, merged 10; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 7, merged 7; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 6, merged 6; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 4, merged 6; iterating... Avg bucket size: 3.14686e+06 (target: 4425266) Converting suffix-array elements to index image Allocating ftab, absorbFtab Entering Ebwt loop Getting block 1 of 210 Reserving size (4425267) for bucket 1 Getting block 2 of 210 Getting block 3 of 210 Getting block 4 of 210 Getting block 5 of 210 Getting block 6 of 210 Getting block 7 of 210 Getting block 8 of 210 Getting block 9 of 210 Getting block 10 of 210 Getting block 11 of 210 Getting block 12 of 210 Calculating Z arrays for bucket 1 Reserving size (4425267) for bucket 2 Getting block 13 of 210 Reserving size (4425267) for bucket 3 Reserving size (4425267) for bucket 4 Reserving size (4425267) for bucket 5 Reserving size (4425267) for bucket 6 Reserving size (4425267) for bucket 7 Reserving size (4425267) for bucket 8 Getting block 14 of 210 Getting block 15 of 210 Getting block 16 of 210 Getting block 17 of 210 Getting block 18 of 210 Getting block 19 of 210 Getting block 20 of 210 Getting block 21 of 210 Getting block 22 of 210 Getting block 23 of 210 Getting block 24 of 210 Reserving size (4425267) for bucket 9 Reserving size (4425267) for bucket 10 Reserving size (4425267) for bucket 11 Getting block 25 of 210 Reserving size (4425267) for bucket 12 Getting block 26 of 210 Entering block accumulator loop for bucket 1: Calculating Z arrays for bucket 2 Reserving size (4425267) for bucket 13 Calculating Z arrays for bucket 3 Calculating Z arrays for bucket 4 Calculating Z arrays for bucket 6 Calculating Z arrays for bucket 5 Calculating Z arrays for bucket 8 Calculating Z arrays for bucket 7 Reserving size (4425267) for bucket 14 Reserving size (4425267) for bucket 15 Reserving size (4425267) for bucket 16 Reserving size (4425267) for bucket 17 Reserving size (4425267) for bucket 18 Reserving size (4425267) for bucket 19 Reserving size (4425267) for bucket 20 Reserving size (4425267) for bucket 21 Reserving size (4425267) for bucket 22 Reserving size (4425267) for bucket 23 Reserving size (4425267) for bucket 24 Calculating Z arrays for bucket 9 Calculating Z arrays for bucket 10 Calculating Z arrays for bucket 11 Reserving size (4425267) for bucket 25 Calculating Z arrays for bucket 12 Reserving size (4425267) for bucket 26 Getting block 27 of 210 Entering block accumulator loop for bucket 2: Calculating Z arrays for bucket 13 Entering block accumulator loop for bucket 3: Entering block accumulator loop for bucket 4: Entering block accumulator loop for bucket 6: Calculating Z arrays for bucket 14 Entering block accumulator loop for bucket 5: Entering block accumulator loop for bucket 8: Entering block accumulator loop for bucket 7: Calculating Z arrays for bucket 15 Calculating Z arrays for bucket 18 Calculating Z arrays for bucket 16 Calculating Z arrays for bucket 17 Calculating Z arrays for bucket 20 Calculating Z arrays for bucket 21 Calculating Z arrays for bucket 22 Calculating Z arrays for bucket 19 Calculating Z arrays for bucket 23 Calculating Z arrays for bucket 26 Reserving size (4425267) for bucket 27 Calculating Z arrays for bucket 24 Calculating Z arrays for bucket 25 Entering block accumulator loop for bucket 10: Entering block accumulator loop for bucket 12: Entering block accumulator loop for bucket 11: Entering block accumulator loop for bucket 9: Entering block accumulator loop for bucket 13: Entering block accumulator loop for bucket 14: Entering block accumulator loop for bucket 15: Entering block accumulator loop for bucket 18: Entering block accumulator loop for bucket 17: Entering block accumulator loop for bucket 20: Entering block accumulator loop for bucket 16: Calculating Z arrays for bucket 27 Entering block accumulator loop for bucket 21: Entering block accumulator loop for bucket 22: Entering block accumulator loop for bucket 19: Entering block accumulator loop for bucket 23: Entering block accumulator loop for bucket 24: Entering block accumulator loop for bucket 25: Entering block accumulator loop for bucket 26: Entering block accumulator loop for bucket 27: Splitting and merging Splitting and merging time: 00:00:00 Split 3, merged 5; iterating... Avg bucket size: 3.3208e+06 (target: 4425266) Converting suffix-array elements to index image Allocating ftab, absorbFtab Entering Ebwt loop Getting block 1 of 199 Getting block 4 of 199 Getting block 2 of 199 Getting block 3 of 199 Reserving size (4425267) for bucket 1 Getting block 5 of 199 Reserving size (4425267) for bucket 4 Reserving size (4425267) for bucket 2 Getting block 6 of 199 Reserving size (4425267) for bucket 3 Getting block 7 of 199 Getting block 8 of 199 Getting block 9 of 199 Getting block 10 of 199 Getting block 11 of 199 Getting block 12 of 199 Getting block 13 of 199 Getting block 14 of 199 Getting block 15 of 199 Getting block 16 of 199 Getting block 17 of 199 Getting block 18 of 199 Getting block 19 of 199 Getting block 20 of 199 Getting block 21 of 199 Getting block 22 of 199 Getting block 23 of 199 Getting block 24 of 199 Calculating Z arrays for bucket 1 Reserving size (4425267) for bucket 5 Getting block 25 of 199 Getting block 26 of 199 Calculating Z arrays for bucket 4 Calculating Z arrays for bucket 2 Reserving size (4425267) for bucket 6 Calculating Z arrays for bucket 3 Reserving size (4425267) for bucket 7 Reserving size (4425267) for bucket 8 Reserving size (4425267) for bucket 9 Reserving size (4425267) for bucket 10 Reserving size (4425267) for bucket 11 Reserving size (4425267) for bucket 12 Reserving size (4425267) for bucket 13 Reserving size (4425267) for bucket 14 Reserving size (4425267) for bucket 15 Reserving size (4425267) for bucket 16 Reserving size (4425267) for bucket 17 Reserving size (4425267) for bucket 18 Reserving size (4425267) for bucket 19 Reserving size (4425267) for bucket 20 Reserving size (4425267) for bucket 21 Reserving size (4425267) for bucket 22 Reserving size (4425267) for bucket 23 Reserving size (4425267) for bucket 24 Entering block accumulator loop for bucket 1: Calculating Z arrays for bucket 5 Reserving size (4425267) for bucket 25 Reserving size (4425267) for bucket 26 Entering block accumulator loop for bucket 4: Calculating Z arrays for bucket 6 Entering block accumulator loop for bucket 2: Calculating Z arrays for bucket 8 Calculating Z arrays for bucket 7 Entering block accumulator loop for bucket 3: Calculating Z arrays for bucket 10 Calculating Z arrays for bucket 11 Calculating Z arrays for bucket 12 Calculating Z arrays for bucket 9 Calculating Z arrays for bucket 15 Calculating Z arrays for bucket 16 Calculating Z arrays for bucket 13 Calculating Z arrays for bucket 18 Calculating Z arrays for bucket 14 Calculating Z arrays for bucket 19 Calculating Z arrays for bucket 20 Calculating Z arrays for bucket 23 Calculating Z arrays for bucket 24 Calculating Z arrays for bucket 17 Calculating Z arrays for bucket 21 Calculating Z arrays for bucket 26 Calculating Z arrays for bucket 22 Calculating Z arrays for bucket 25 Entering block accumulator loop for bucket 6: Entering block accumulator loop for bucket 5: Entering block accumulator loop for bucket 10: Entering block accumulator loop for bucket 7: Entering block accumulator loop for bucket 8: Entering block accumulator loop for bucket 9: Entering block accumulator loop for bucket 11: Entering block accumulator loop for bucket 12: Entering block accumulator loop for bucket 16: Entering block accumulator loop for bucket 14: Entering block accumulator loop for bucket 19: Entering block accumulator loop for bucket 15: Entering block accumulator loop for bucket 18: Entering block accumulator loop for bucket 20: Entering block accumulator loop for bucket 13: Entering block accumulator loop for bucket 21: Entering block accumulator loop for bucket 26: Entering block accumulator loop for bucket 22: Entering block accumulator loop for bucket 17: Entering block accumulator loop for bucket 25: Entering block accumulator loop for bucket 23: Entering block accumulator loop for bucket 24: Getting block 27 of 199 Reserving size (4425267) for bucket 27 Calculating Z arrays for bucket 27 Entering block accumulator loop for bucket 27: bucket 3: 10% bucket 1: 10% bucket 4: 10% bucket 9: 10% bucket 5: 10% bucket 13: 10% bucket 7: 10% bucket 11: 10% bucket 10: 10% bucket 6: 10% bucket 14: 10% bucket 26: 10% bucket 8: 10% bucket 2: 10% bucket 15: 10% bucket 25: 10% bucket 23: 10% bucket 17: 10% bucket 9: 10% bucket 21: 10% bucket 1: 20% bucket 16: 10% bucket 19: 10% bucket 20: 10% bucket 12: 10% bucket 9: 20% bucket 5: 20% bucket 14: 10% bucket 22: 10% bucket 6: 20% bucket 3: 20% bucket 2: 10% bucket 24: 10% bucket 18: 10% bucket 27: 10% bucket 3: 10% bucket 20: 10% bucket 7: 20% bucket 27: 10% bucket 4: 10% bucket 6: 10% bucket 13: 20% bucket 17: 20% bucket 13: 10% bucket 10: 20% bucket 11: 10% bucket 8: 10% bucket 3: 30% bucket 11: 20% bucket 5: 10% bucket 1: 30% bucket 26: 20% bucket 17: 10% bucket 1: 10% bucket 2: 20% bucket 19: 10% bucket 2: 20% bucket 4: 20% bucket 22: 10% bucket 9: 30% bucket 15: 10% bucket 14: 20% bucket 3: 20% bucket 14: 20% bucket 18: 10% bucket 16: 10% bucket 9: 20% bucket 7: 30% bucket 23: 20% bucket 21: 10% bucket 7: 10% bucket 23: 10% bucket 12: 10% bucket 8: 20% bucket 10: 10% bucket 6: 30% bucket 27: 20% bucket 13: 30% bucket 25: 20% bucket 5: 30% bucket 25: 10% bucket 16: 20% bucket 24: 10% bucket 26: 10% bucket 2: 30% bucket 12: 20% bucket 15: 20% bucket 19: 20% bucket 20: 20% bucket 4: 20% bucket 24: 20% bucket 17: 20% bucket 13: 20% bucket 26: 30% bucket 11: 30% bucket 14: 30% bucket 17: 30% bucket 1: 40% bucket 3: 40% bucket 21: 20% bucket 18: 20% bucket 10: 30% bucket 14: 30% bucket 22: 20% bucket 27: 20% bucket 20: 20% bucket 8: 30% bucket 3: 30% bucket 7: 40% bucket 5: 20% bucket 9: 30% bucket 18: 20% bucket 9: 40% bucket 2: 40% bucket 2: 30% bucket 4: 30% bucket 11: 40% bucket 6: 20% bucket 8: 20% bucket 6: 40% bucket 3: 50% bucket 1: 50% bucket 22: 20% bucket 17: 40% bucket 23: 30% bucket 11: 20% bucket 1: 20% bucket 19: 20% bucket 13: 40% bucket 5: 40% bucket 25: 20% bucket 24: 30% bucket 10: 40% bucket 25: 30% bucket 27: 30% bucket 23: 20% bucket 12: 30% bucket 16: 20% bucket 7: 20% bucket 15: 30% bucket 13: 30% bucket 19: 30% bucket 4: 30% bucket 21: 20% bucket 22: 30% bucket 12: 20% bucket 15: 20% bucket 20: 30% bucket 16: 30% bucket 10: 20% bucket 14: 40% bucket 26: 40% bucket 17: 30% bucket 24: 20% bucket 3: 60% bucket 26: 20% bucket 21: 30% bucket 8: 40% bucket 2: 40% bucket 2: 50% bucket 14: 40% bucket 27: 30% bucket 3: 40% bucket 7: 50% bucket 24: 40% bucket 4: 40% bucket 11: 50% bucket 9: 50% bucket 18: 30% bucket 17: 50% bucket 18: 30% bucket 5: 30% bucket 20: 30% bucket 9: 40% bucket 1: 60% bucket 6: 50% bucket 6: 30% bucket 8: 30% bucket 10: 50% bucket 5: 50% bucket 2: 60% bucket 1: 30% bucket 21: 30% bucket 13: 50% bucket 23: 40% bucket 11: 30% bucket 22: 30% bucket 19: 30% bucket 25: 30% bucket 12: 40% bucket 15: 40% bucket 25: 40% bucket 7: 30% bucket 16: 30% bucket 4: 40% bucket 19: 40% bucket 22: 40% bucket 23: 30% bucket 13: 40% bucket 3: 70% bucket 16: 40% bucket 27: 40% bucket 6: 60% bucket 20: 40% bucket 12: 30% bucket 15: 30% bucket 14: 50% bucket 8: 50% bucket 10: 30% bucket 26: 50% bucket 17: 40% bucket 21: 40% bucket 2: 50% bucket 7: 60% bucket 4: 50% bucket 11: 60% bucket 9: 60% bucket 24: 30% bucket 1: 70% bucket 3: 50% bucket 26: 30% bucket 14: 50% bucket 24: 50% bucket 27: 40% bucket 18: 40% bucket 5: 40% bucket 17: 60% bucket 21: 40% bucket 9: 50% bucket 2: 70% bucket 18: 40% bucket 5: 60% bucket 6: 70% bucket 20: 40% bucket 6: 40% bucket 10: 60% bucket 8: 40% bucket 1: 40% bucket 13: 60% bucket 8: 60% bucket 23: 50% bucket 12: 50% bucket 11: 40% bucket 22: 40% bucket 15: 50% bucket 19: 40% bucket 3: 80% bucket 25: 40% bucket 4: 50% bucket 5: 50% bucket 7: 40% bucket 19: 50% bucket 22: 50% bucket 21: 50% bucket 25: 50% bucket 16: 50% bucket 16: 40% bucket 14: 60% bucket 20: 50% bucket 12: 40% bucket 13: 50% bucket 15: 40% bucket 23: 40% bucket 1: 80% bucket 4: 60% bucket 10: 40% bucket 7: 70% bucket 27: 50% bucket 11: 70% bucket 9: 70% bucket 21: 50% bucket 2: 60% bucket 26: 60% bucket 17: 50% bucket 3: 60% bucket 2: 80% bucket 8: 70% bucket 14: 60% bucket 24: 60% bucket 6: 80% bucket 24: 40% bucket 26: 40% bucket 5: 70% bucket 27: 50% bucket 17: 70% bucket 18: 50% bucket 5: 60% bucket 10: 70% bucket 9: 60% bucket 6: 50% bucket 18: 50% bucket 1: 50% bucket 20: 50% bucket 13: 70% bucket 8: 50% bucket 12: 60% bucket 3: 90% bucket 23: 60% bucket 11: 50% bucket 15: 60% bucket 21: 60% bucket 4: 60% bucket 5: 70% bucket 1: 90% bucket 19: 60% bucket 7: 50% bucket 19: 50% bucket 22: 50% bucket 14: 70% bucket 16: 60% bucket 14: 70% bucket 22: 60% bucket 4: 70% bucket 25: 60% bucket 20: 60% bucket 25: 50% bucket 7: 80% bucket 16: 50% bucket 9: 80% bucket 11: 80% bucket 12: 50% bucket 15: 50% bucket 8: 80% bucket 13: 60% bucket 2: 70% bucket 10: 50% bucket 2: 90% bucket 27: 60% bucket 21: 60% bucket 23: 50% bucket 26: 70% bucket 6: 90% bucket 3: 70% bucket 17: 60% bucket 5: 80% bucket 24: 70% bucket 10: 80% bucket 17: 80% bucket 27: 60% bucket 18: 60% bucket 14: 80% bucket 6: 60% bucket 9: 70% bucket 26: 50% bucket 24: 50% bucket 1: 60% bucket 13: 80% bucket 3: 100% Sorting block of length 2688378 for bucket 3 (Using difference cover) bucket 18: 60% bucket 12: 70% bucket 8: 60% bucket 20: 60% bucket 4: 70% bucket 1: 100% Sorting block of length 4304910 for bucket 1 (Using difference cover) bucket 23: 70% bucket 15: 70% bucket 11: 60% bucket 27: 70% bucket 5: 80% bucket 4: 80% bucket 14: 80% bucket 16: 70% bucket 19: 70% bucket 7: 90% bucket 7: 60% bucket 22: 70% bucket 21: 70% bucket 11: 90% bucket 9: 90% bucket 2: 100% Sorting block of length 2616149 for bucket 2 (Using difference cover) bucket 25: 70% bucket 19: 60% bucket 8: 90% bucket 20: 70% bucket 22: 60% bucket 13: 90% bucket 16: 60% bucket 2: 80% bucket 6: 100% Sorting block of length 2182367 for bucket 6 (Using difference cover) bucket 12: 60% bucket 15: 60% bucket 21: 70% bucket 25: 60% bucket 13: 70% bucket 5: 90% bucket 10: 60% bucket 3: 80% bucket 26: 80% bucket 23: 60% bucket 17: 70% bucket 24: 60% bucket 4: 80% bucket 10: 90% bucket 14: 90% bucket 24: 80% bucket 17: 90% bucket 6: 70% bucket 1: 70% bucket 18: 70% bucket 9: 80% bucket 27: 70% bucket 12: 80% bucket 27: 80% bucket 8: 70% bucket 26: 60% bucket 18: 70% bucket 20: 70% bucket 15: 80% bucket 4: 90% bucket 23: 80% bucket 7: 100% Sorting block of length 3455994 for bucket 7 (Using difference cover) bucket 9: 100% Sorting block of length 3503442 for bucket 9 (Using difference cover) bucket 11: 100% Sorting block of length 1845171 for bucket 11 (Using difference cover) bucket 11: 70% bucket 13: 100% Sorting block of length 3061405 for bucket 13 (Using difference cover) bucket 24: 70% bucket 5: 90% bucket 14: 90% bucket 8: 100% Sorting block of length 3490226 for bucket 8 (Using difference cover) bucket 16: 80% bucket 19: 80% bucket 7: 70% bucket 22: 80% bucket 20: 80% bucket 5: 100% Sorting block of length 2387740 for bucket 5 (Using difference cover) bucket 25: 80% bucket 21: 80% bucket 19: 70% bucket 2: 90% bucket 21: 80% bucket 16: 70% bucket 12: 70% bucket 15: 70% bucket 22: 70% bucket 10: 70% bucket 13: 80% bucket 26: 90% bucket 25: 70% bucket 10: 100% Sorting block of length 3815031 for bucket 10 (Using difference cover) bucket 3: 90% bucket 4: 90% bucket 9: 90% Sorting block time: 00:00:02 Returning block of 2688379 for bucket 3 bucket 17: 80% bucket 23: 70% bucket 17: 100% Sorting block of length 3603404 for bucket 17 (Using difference cover) bucket 24: 90% bucket 1: 80% bucket 6: 80% bucket 14: 100% Sorting block of length 3208335 for bucket 14 (Using difference cover) Getting block 28 of 210 Reserving size (4425267) for bucket 28 Calculating Z arrays for bucket 28 Entering block accumulator loop for bucket 28: bucket 19: 90% bucket 27: 90% bucket 27: 80% bucket 4: 100% Sorting block of length 4213294 for bucket 4 (Using difference cover) bucket 12: 90% bucket 8: 80% Sorting block time: 00:00:02 Returning block of 2182368 for bucket 6 bucket 15: 90% bucket 18: 80% bucket 18: 80% bucket 24: 80% Getting block 29 of 210 Reserving size (4425267) for bucket 29 Calculating Z arrays for bucket 29 Entering block accumulator loop for bucket 29: bucket 26: 100% Sorting block of length 3176925 for bucket 26 (Using difference cover) bucket 20: 80% bucket 23: 90% bucket 14: 100% Sorting block of length 2117681 for bucket 14 (Using difference cover) bucket 16: 90% bucket 2: 100% Sorting block of length 4351848 for bucket 2 (Using difference cover) bucket 5: 100% Sorting block of length 2427901 for bucket 5 (Using difference cover) bucket 11: 80% Sorting block time: 00:00:02 Returning block of 2616150 for bucket 2 bucket 22: 90% bucket 7: 80% bucket 26: 70% Getting block 30 of 210 Reserving size (4425267) for bucket 30 Calculating Z arrays for bucket 30 Entering block accumulator loop for bucket 30: bucket 20: 90% bucket 9: 100% Sorting block of length 4363745 for bucket 9 (Using difference cover) bucket 25: 90% bucket 21: 90% bucket 19: 100% Sorting block of length 3414534 for bucket 19 (Using difference cover) bucket 19: 80% Sorting block time: 00:00:01 Returning block of 1845172 for bucket 11 bucket 21: 90% bucket 15: 80% bucket 12: 80% bucket 16: 80% Getting block 31 of 210 Reserving size (4425267) for bucket 31 Calculating Z arrays for bucket 31 Entering block accumulator loop for bucket 31: bucket 10: 80% bucket 22: 80% bucket 3: 100% Sorting block of length 4405111 for bucket 3 (Using difference cover) bucket 13: 90% bucket 4: 100% Sorting block of length 3196689 for bucket 4 (Using difference cover) bucket 24: 100% Sorting block of length 3439460 for bucket 24 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4304911 for bucket 1 bucket 25: 80% bucket 1: 90% bucket 17: 90% bucket 29: 10% bucket 6: 90% bucket 23: 80% Getting block 32 of 210 Reserving size (4425267) for bucket 32 Calculating Z arrays for bucket 32 Entering block accumulator loop for bucket 32: bucket 28: 10% bucket 15: 100% Sorting block of length 4096416 for bucket 15 (Using difference cover) bucket 27: 90% bucket 12: 100% Sorting block of length 4017242 for bucket 12 (Using difference cover) bucket 20: 100% Sorting block of length 2821002 for bucket 20 (Using difference cover) bucket 8: 90% bucket 27: 100% Sorting block of length 4409376 for bucket 27 (Using difference cover) bucket 18: 90% bucket 18: 90% bucket 23: 100% Sorting block of length 1471185 for bucket 23 (Using difference cover) bucket 16: 100% Sorting block of length 4170435 for bucket 16 (Using difference cover) bucket 24: 90% bucket 20: 90% bucket 22: 100% Sorting block of length 2334560 for bucket 22 (Using difference cover) bucket 11: 90% bucket 7: 90% Sorting block time: 00:00:02 Returning block of 3503443 for bucket 9 Sorting block time: 00:00:02 Returning block of 3490227 for bucket 8 bucket 30: 10% bucket 21: 100% Sorting block of length 3599271 for bucket 21 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2387741 for bucket 5 bucket 26: 80% bucket 25: 100% Sorting block of length 1512425 for bucket 25 (Using difference cover) Getting block 33 of 210 Reserving size (4425267) for bucket 33 Calculating Z arrays for bucket 33 Entering block accumulator loop for bucket 33: Getting block 34 of 210 Reserving size (4425267) for bucket 34 Calculating Z arrays for bucket 34 Entering block accumulator loop for bucket 34: Getting block 35 of 210 Reserving size (4425267) for bucket 35 Calculating Z arrays for bucket 35 Entering block accumulator loop for bucket 35: bucket 15: 90% bucket 12: 90% bucket 19: 90% bucket 16: 90% bucket 10: 90% Sorting block time: 00:00:02 Returning block of 3061406 for bucket 13 bucket 21: 100% Sorting block of length 4037668 for bucket 21 (Using difference cover) bucket 31: 10% bucket 13: 100% Sorting block of length 3615354 for bucket 13 (Using difference cover) bucket 22: 90% Sorting block time: 00:00:03 Returning block of 3455995 for bucket 7 bucket 1: 100% Sorting block of length 3224309 for bucket 1 (Using difference cover) Getting block 36 of 210 Reserving size (4425267) for bucket 36 Calculating Z arrays for bucket 36 Entering block accumulator loop for bucket 36: bucket 6: 100% Sorting block of length 2222327 for bucket 6 (Using difference cover) bucket 29: 20% bucket 17: 100% Sorting block of length 2647161 for bucket 17 (Using difference cover) bucket 25: 90% Getting block 37 of 210 Reserving size (4425267) for bucket 37 Calculating Z arrays for bucket 37 Entering block accumulator loop for bucket 37: bucket 28: 20% bucket 30: 20% bucket 23: 90% bucket 32: 10% bucket 8: 100% Sorting block of length 3536792 for bucket 8 (Using difference cover) bucket 27: 100% Sorting block of length 3130375 for bucket 27 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2117682 for bucket 14 Sorting block time: 00:00:02 Returning block of 3176926 for bucket 26 Getting block 38 of 210 Reserving size (4425267) for bucket 38 Calculating Z arrays for bucket 38 Entering block accumulator loop for bucket 38: Sorting block time: 00:00:02 Returning block of 2427902 for bucket 5 bucket 18: 100% Sorting block of length 3042285 for bucket 18 (Using difference cover) Sorting block time: 00:00:01 Returning block of 1471186 for bucket 23 Sorting block time: 00:00:03 Returning block of 3208336 for bucket 14 bucket 18: 100% Sorting block of length 3887857 for bucket 18 (Using difference cover) Getting block 39 of 210 Reserving size (4425267) for bucket 39 Calculating Z arrays for bucket 39 Entering block accumulator loop for bucket 39: Getting block 40 of 210 Reserving size (4425267) for bucket 40 Calculating Z arrays for bucket 40 Entering block accumulator loop for bucket 40: Getting block 28 of 199 Reserving size (4425267) for bucket 28 Calculating Z arrays for bucket 28 Entering block accumulator loop for bucket 28: bucket 20: 100% Sorting block of length 2850653 for bucket 20 (Using difference cover) Getting block 29 of 199 Reserving size (4425267) for bucket 29 Calculating Z arrays for bucket 29 Entering block accumulator loop for bucket 29: bucket 11: 100% Sorting block of length 3558733 for bucket 11 (Using difference cover) bucket 7: 100% Sorting block of length 3372081 for bucket 7 (Using difference cover) bucket 24: 100% Sorting block of length 4408698 for bucket 24 (Using difference cover) bucket 22: 100% Sorting block of length 3916641 for bucket 22 (Using difference cover) Sorting block time: 00:00:01 Returning block of 1512426 for bucket 25 Sorting block time: 00:00:02 Returning block of 4363746 for bucket 9 Getting block 41 of 210 Reserving size (4425267) for bucket 41 Calculating Z arrays for bucket 41 Entering block accumulator loop for bucket 41: bucket 26: 90% Sorting block time: 00:00:04 Returning block of 3603405 for bucket 17 bucket 15: 100% Sorting block of length 1798442 for bucket 15 (Using difference cover) Sorting block time: 00:00:04 Returning block of 3815032 for bucket 10 bucket 34: 10% bucket 12: 100% Sorting block of length 4318825 for bucket 12 (Using difference cover) bucket 33: 10% bucket 16: 100% Sorting block of length 2634939 for bucket 16 (Using difference cover) bucket 35: 10% bucket 19: 100% Sorting block of length 2421619 for bucket 19 (Using difference cover) Getting block 30 of 199 Reserving size (4425267) for bucket 30 Calculating Z arrays for bucket 30 Entering block accumulator loop for bucket 30: bucket 10: 100% Sorting block of length 2632767 for bucket 10 (Using difference cover) Getting block 42 of 210 Reserving size (4425267) for bucket 42 Calculating Z arrays for bucket 42 Entering block accumulator loop for bucket 42: Getting block 43 of 210 Reserving size (4425267) for bucket 43 Calculating Z arrays for bucket 43 Entering block accumulator loop for bucket 43: bucket 31: 20% Sorting block time: 00:00:03 Returning block of 3414535 for bucket 19 bucket 36: 10% bucket 28: 30% Getting block 44 of 210 Reserving size (4425267) for bucket 44 Calculating Z arrays for bucket 44 Entering block accumulator loop for bucket 44: bucket 29: 30% bucket 25: 100% Sorting block of length 3438984 for bucket 25 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2334561 for bucket 22 bucket 37: 10% bucket 30: 30% Getting block 45 of 210 Reserving size (4425267) for bucket 45 Calculating Z arrays for bucket 45 Entering block accumulator loop for bucket 45: bucket 29: 10% bucket 23: 100% Sorting block of length 3476954 for bucket 23 (Using difference cover) bucket 32: 20% bucket 38: 10% Sorting block time: 00:00:03 Returning block of 3196690 for bucket 4 Sorting block time: 00:00:04 Returning block of 4213295 for bucket 4 Sorting block time: 00:00:03 Returning block of 3439461 for bucket 24 Getting block 31 of 199 Reserving size (4425267) for bucket 31 Calculating Z arrays for bucket 31 Entering block accumulator loop for bucket 31: bucket 39: 10% bucket 28: 10% Getting block 46 of 210 Reserving size (4425267) for bucket 46 Calculating Z arrays for bucket 46 Entering block accumulator loop for bucket 46: bucket 40: 10% Getting block 47 of 210 Reserving size (4425267) for bucket 47 Calculating Z arrays for bucket 47 Entering block accumulator loop for bucket 47: bucket 41: 10% bucket 31: 30% Sorting block time: 00:00:02 Returning block of 2222328 for bucket 6 Sorting block time: 00:00:03 Returning block of 4096417 for bucket 15 bucket 34: 20% Getting block 32 of 199 Reserving size (4425267) for bucket 32 Calculating Z arrays for bucket 32 Entering block accumulator loop for bucket 32: bucket 29: 40% bucket 28: 40% bucket 26: 100% Sorting block of length 4039085 for bucket 26 (Using difference cover) Getting block 48 of 210 Reserving size (4425267) for bucket 48 Calculating Z arrays for bucket 48 Entering block accumulator loop for bucket 48: bucket 33: 20% bucket 30: 10% bucket 42: 10% bucket 35: 20% bucket 43: 10% bucket 36: 20% Sorting block time: 00:00:03 Returning block of 2821003 for bucket 20 bucket 29: 20% Sorting block time: 00:00:01 Returning block of 1798443 for bucket 15 bucket 30: 40% bucket 44: 10% bucket 37: 20% Sorting block time: 00:00:02 Returning block of 2647162 for bucket 17 Getting block 33 of 199 Reserving size (4425267) for bucket 33 Calculating Z arrays for bucket 33 Entering block accumulator loop for bucket 33: Getting block 49 of 210 Reserving size (4425267) for bucket 49 Calculating Z arrays for bucket 49 Entering block accumulator loop for bucket 49: Sorting block time: 00:00:02 Returning block of 3130376 for bucket 27 Getting block 34 of 199 Reserving size (4425267) for bucket 34 Calculating Z arrays for bucket 34 Entering block accumulator loop for bucket 34: bucket 45: 10% Sorting block time: 00:00:04 Returning block of 4017243 for bucket 12 Getting block 50 of 210 Reserving size (4425267) for bucket 50 Calculating Z arrays for bucket 50 Entering block accumulator loop for bucket 50: bucket 32: 30% bucket 38: 20% Sorting block time: 00:00:05 Returning block of 4405112 for bucket 3 Getting block 51 of 210 Reserving size (4425267) for bucket 51 Calculating Z arrays for bucket 51 Entering block accumulator loop for bucket 51: bucket 29: 50% Sorting block time: 00:00:04 Returning block of 3599272 for bucket 21 bucket 39: 20% bucket 31: 40% Sorting block time: 00:00:03 Returning block of 3042286 for bucket 18 bucket 28: 20% Sorting block time: 00:00:03 Returning block of 3536793 for bucket 8 Getting block 35 of 199 Reserving size (4425267) for bucket 35 Calculating Z arrays for bucket 35 Entering block accumulator loop for bucket 35: bucket 41: 20% Sorting block time: 00:00:03 Returning block of 2850654 for bucket 20 Sorting block time: 00:00:03 Returning block of 3615355 for bucket 13 bucket 46: 10% Sorting block time: 00:00:02 Returning block of 2421620 for bucket 19 bucket 40: 20% Sorting block time: 00:00:04 Returning block of 4409377 for bucket 27 Getting block 52 of 210 Reserving size (4425267) for bucket 52 Calculating Z arrays for bucket 52 Entering block accumulator loop for bucket 52: bucket 31: 10% Getting block 53 of 210 Reserving size (4425267) for bucket 53 Calculating Z arrays for bucket 53 Entering block accumulator loop for bucket 53: Getting block 36 of 199 Reserving size (4425267) for bucket 36 Calculating Z arrays for bucket 36 Entering block accumulator loop for bucket 36: bucket 47: 10% Getting block 37 of 199 Reserving size (4425267) for bucket 37 Calculating Z arrays for bucket 37 Entering block accumulator loop for bucket 37: Sorting block time: 00:00:03 Returning block of 3372082 for bucket 7 Sorting block time: 00:00:02 Returning block of 2632768 for bucket 10 Getting block 38 of 199 Reserving size (4425267) for bucket 38 Calculating Z arrays for bucket 38 Entering block accumulator loop for bucket 38: Getting block 39 of 199 Reserving size (4425267) for bucket 39 Calculating Z arrays for bucket 39 Entering block accumulator loop for bucket 39: bucket 34: 30% Getting block 40 of 199 Reserving size (4425267) for bucket 40 Calculating Z arrays for bucket 40 Entering block accumulator loop for bucket 40: Getting block 41 of 199 Reserving size (4425267) for bucket 41 Calculating Z arrays for bucket 41 Entering block accumulator loop for bucket 41: Getting block 42 of 199 Reserving size (4425267) for bucket 42 Calculating Z arrays for bucket 42 Entering block accumulator loop for bucket 42: bucket 32: 10% Sorting block time: 00:00:05 Returning block of 4351849 for bucket 2 Sorting block time: 00:00:04 Returning block of 4170436 for bucket 16 bucket 49: 10% bucket 28: 50% Sorting block time: 00:00:02 Returning block of 2634940 for bucket 16 bucket 36: 30% Sorting block time: 00:00:04 Returning block of 4037669 for bucket 21 bucket 42: 20% Sorting block time: 00:00:03 Returning block of 3916642 for bucket 22 Getting block 43 of 199 Reserving size (4425267) for bucket 43 Calculating Z arrays for bucket 43 Entering block accumulator loop for bucket 43: bucket 35: 30% bucket 33: 30% Sorting block time: 00:00:03 Returning block of 3558734 for bucket 11 bucket 30: 20% Getting block 54 of 210 Reserving size (4425267) for bucket 54 Calculating Z arrays for bucket 54 Entering block accumulator loop for bucket 54: bucket 48: 10% Getting block 44 of 199 Reserving size (4425267) for bucket 44 Calculating Z arrays for bucket 44 Entering block accumulator loop for bucket 44: bucket 43: 20% Getting block 45 of 199 Reserving size (4425267) for bucket 45 Calculating Z arrays for bucket 45 Entering block accumulator loop for bucket 45: Getting block 46 of 199 Reserving size (4425267) for bucket 46 Calculating Z arrays for bucket 46 Entering block accumulator loop for bucket 46: Getting block 47 of 199 Reserving size (4425267) for bucket 47 Calculating Z arrays for bucket 47 Entering block accumulator loop for bucket 47: bucket 30: 50% bucket 34: 10% bucket 29: 30% bucket 37: 30% bucket 44: 20% bucket 33: 10% bucket 45: 20% Sorting block time: 00:00:04 Returning block of 3887858 for bucket 18 Sorting block time: 00:00:03 Returning block of 3438985 for bucket 25 Sorting block time: 00:00:03 Returning block of 3476955 for bucket 23 bucket 32: 40% bucket 38: 30% Getting block 48 of 199 Reserving size (4425267) for bucket 48 Calculating Z arrays for bucket 48 Entering block accumulator loop for bucket 48: Getting block 49 of 199 Reserving size (4425267) for bucket 49 Calculating Z arrays for bucket 49 Entering block accumulator loop for bucket 49: bucket 50: 10% bucket 29: 60% bucket 39: 30% bucket 31: 50% Getting block 50 of 199 Reserving size (4425267) for bucket 50 Calculating Z arrays for bucket 50 Entering block accumulator loop for bucket 50: bucket 41: 30% bucket 47: 20% bucket 51: 10% bucket 40: 30% bucket 35: 40% bucket 35: 10% bucket 46: 20% Sorting block time: 00:00:04 Returning block of 4408699 for bucket 24 bucket 49: 20% bucket 52: 10% bucket 36: 10% Sorting block time: 00:00:03 Returning block of 4318826 for bucket 12 bucket 34: 40% bucket 53: 10% bucket 31: 20% bucket 28: 30% bucket 37: 10% bucket 28: 60% Getting block 51 of 199 Reserving size (4425267) for bucket 51 Calculating Z arrays for bucket 51 Entering block accumulator loop for bucket 51: bucket 30: 60% bucket 39: 10% bucket 38: 10% bucket 36: 40% bucket 32: 20% bucket 41: 10% bucket 42: 10% Getting block 52 of 199 Reserving size (4425267) for bucket 52 Calculating Z arrays for bucket 52 Entering block accumulator loop for bucket 52: bucket 42: 30% bucket 40: 10% bucket 43: 10% bucket 30: 30% bucket 44: 10% bucket 34: 20% bucket 48: 20% bucket 33: 40% bucket 54: 10% bucket 44: 30% bucket 43: 30% bucket 47: 30% bucket 37: 40% bucket 45: 10% bucket 46: 10% bucket 47: 10% bucket 51: 20% Sorting block time: 00:00:03 Returning block of 4039086 for bucket 26 bucket 29: 40% bucket 45: 30% bucket 33: 20% bucket 38: 40% Getting block 53 of 199 Reserving size (4425267) for bucket 53 Calculating Z arrays for bucket 53 Entering block accumulator loop for bucket 53: bucket 32: 50% bucket 36: 20% bucket 31: 60% bucket 29: 70% bucket 39: 40% bucket 41: 40% bucket 40: 40% bucket 50: 20% bucket 48: 10% bucket 35: 50% bucket 49: 10% bucket 50: 10% bucket 48: 30% bucket 44: 40% bucket 52: 20% bucket 36: 50% bucket 34: 50% bucket 30: 70% bucket 28: 70% bucket 28: 40% bucket 46: 30% bucket 42: 20% bucket 53: 20% bucket 35: 20% bucket 31: 30% bucket 42: 40% bucket 32: 30% bucket 38: 20% bucket 37: 20% bucket 49: 30% bucket 39: 20% bucket 51: 10% bucket 41: 20% bucket 34: 30% bucket 33: 50% bucket 40: 20% bucket 52: 10% bucket 43: 20% bucket 44: 20% bucket 30: 40% bucket 54: 20% bucket 37: 50% bucket 53: 10% bucket 31: 70% bucket 47: 40% bucket 43: 40% bucket 29: 50% bucket 46: 20% bucket 51: 30% bucket 38: 50% bucket 45: 40% bucket 45: 20% bucket 33: 30% bucket 47: 20% bucket 32: 60% bucket 39: 50% bucket 41: 50% bucket 40: 50% bucket 29: 80% bucket 53: 30% bucket 36: 30% bucket 35: 60% Sorting block time: 00:00:07 Returning block of 3224310 for bucket 1 bucket 49: 20% bucket 50: 30% Getting block 54 of 199 Reserving size (4425267) for bucket 54 Calculating Z arrays for bucket 54 Entering block accumulator loop for bucket 54: bucket 48: 40% bucket 48: 20% bucket 44: 50% bucket 50: 20% bucket 30: 80% bucket 28: 80% bucket 52: 30% bucket 34: 60% bucket 36: 60% bucket 41: 30% bucket 46: 40% bucket 42: 50% bucket 28: 50% bucket 32: 40% bucket 42: 30% bucket 35: 30% bucket 38: 60% bucket 53: 40% bucket 51: 20% bucket 31: 40% bucket 33: 60% bucket 39: 60% bucket 39: 30% bucket 37: 60% bucket 38: 30% bucket 54: 30% bucket 49: 40% bucket 37: 30% bucket 31: 80% bucket 47: 50% bucket 44: 30% bucket 40: 30% bucket 29: 60% bucket 45: 50% bucket 34: 40% bucket 48: 50% bucket 43: 50% bucket 43: 30% bucket 51: 40% bucket 40: 60% bucket 35: 70% bucket 41: 60% bucket 29: 90% bucket 52: 20% bucket 30: 50% bucket 53: 20% bucket 32: 70% bucket 38: 70% bucket 33: 40% bucket 44: 60% bucket 46: 30% bucket 50: 40% bucket 49: 30% bucket 36: 40% bucket 28: 90% bucket 52: 40% bucket 36: 70% bucket 42: 60% bucket 35: 40% bucket 34: 70% bucket 30: 90% bucket 33: 70% bucket 45: 60% bucket 32: 50% bucket 37: 70% bucket 53: 50% bucket 46: 50% bucket 45: 30% bucket 47: 30% bucket 41: 40% bucket 44: 70% bucket 48: 60% bucket 35: 80% bucket 54: 40% bucket 39: 70% bucket 47: 60% bucket 51: 30% bucket 31: 90% bucket 50: 50% bucket 40: 70% bucket 54: 10% bucket 51: 50% bucket 49: 50% bucket 41: 70% bucket 42: 40% bucket 50: 30% bucket 29: 100% Sorting block of length 2913050 for bucket 29 (Using difference cover) bucket 48: 30% bucket 31: 50% bucket 43: 60% bucket 38: 80% bucket 29: 70% bucket 28: 60% bucket 32: 80% bucket 39: 40% bucket 44: 40% bucket 28: 100% Sorting block of length 2424595 for bucket 28 (Using difference cover) bucket 54: 50% bucket 49: 40% bucket 42: 70% bucket 33: 50% bucket 34: 50% bucket 52: 50% bucket 43: 40% bucket 34: 80% bucket 39: 80% bucket 37: 40% bucket 40: 40% bucket 45: 70% bucket 36: 80% bucket 38: 40% bucket 33: 80% bucket 53: 30% bucket 30: 60% bucket 36: 50% bucket 32: 60% bucket 46: 40% bucket 37: 80% bucket 44: 80% bucket 53: 60% bucket 35: 90% bucket 30: 100% Sorting block of length 4269372 for bucket 30 (Using difference cover) bucket 40: 80% bucket 43: 70% bucket 48: 70% bucket 47: 70% bucket 46: 60% bucket 50: 60% bucket 31: 100% Sorting block of length 3289718 for bucket 31 (Using difference cover) bucket 41: 80% bucket 52: 30% bucket 41: 50% bucket 35: 50% bucket 51: 60% bucket 45: 40% bucket 38: 90% bucket 34: 60% bucket 49: 60% bucket 47: 40% bucket 42: 50% bucket 32: 90% bucket 31: 60% bucket 54: 60% bucket 43: 80% bucket 29: 80% bucket 48: 40% bucket 52: 60% bucket 42: 80% bucket 54: 20% bucket 39: 90% bucket 37: 90% bucket 45: 80% bucket 34: 90% bucket 33: 90% bucket 47: 80% bucket 35: 100% Sorting block of length 4352730 for bucket 35 (Using difference cover) bucket 39: 50% bucket 36: 90% bucket 38: 100% Sorting block of length 3083860 for bucket 38 (Using difference cover) bucket 50: 40% bucket 44: 90% bucket 43: 50% bucket 40: 90% Sorting block time: 00:00:02 Returning block of 2424596 for bucket 28 bucket 33: 60% bucket 53: 70% Getting block 55 of 210 Reserving size (4425267) for bucket 55 Calculating Z arrays for bucket 55 Entering block accumulator loop for bucket 55: bucket 48: 80% bucket 51: 40% bucket 40: 50% bucket 44: 50% bucket 28: 70% bucket 49: 50% bucket 50: 70% bucket 36: 60% bucket 41: 90% bucket 46: 70% bucket 32: 70% bucket 49: 70% bucket 51: 70% bucket 52: 70% bucket 43: 90% Sorting block time: 00:00:03 Returning block of 2913051 for bucket 29 bucket 30: 70% bucket 41: 60% Getting block 56 of 210 Reserving size (4425267) for bucket 56 Calculating Z arrays for bucket 56 Entering block accumulator loop for bucket 56: bucket 37: 50% bucket 53: 40% bucket 38: 50% bucket 32: 100% Sorting block of length 4149675 for bucket 32 (Using difference cover) bucket 54: 70% bucket 45: 90% bucket 39: 100% Sorting block of length 1628637 for bucket 39 (Using difference cover) bucket 42: 90% bucket 34: 70% bucket 33: 100% Sorting block of length 3072795 for bucket 33 (Using difference cover) bucket 47: 90% Sorting block time: 00:00:02 Returning block of 3289719 for bucket 31 bucket 35: 60% bucket 37: 100% Sorting block of length 3354936 for bucket 37 (Using difference cover) bucket 46: 50% bucket 40: 100% Sorting block of length 3266247 for bucket 40 (Using difference cover) bucket 52: 40% bucket 50: 80% bucket 34: 100% Sorting block of length 2126881 for bucket 34 (Using difference cover) bucket 44: 100% Sorting block of length 2899562 for bucket 44 (Using difference cover) Getting block 57 of 210 Reserving size (4425267) for bucket 57 Calculating Z arrays for bucket 57 Entering block accumulator loop for bucket 57: bucket 45: 50% bucket 36: 100% Sorting block of length 1532907 for bucket 36 (Using difference cover) bucket 42: 60% bucket 53: 80% bucket 50: 50% bucket 48: 90% bucket 29: 90% bucket 43: 60% bucket 41: 100% Sorting block of length 3215427 for bucket 41 (Using difference cover) bucket 55: 10% bucket 51: 80% bucket 54: 30% bucket 48: 50% bucket 52: 80% bucket 47: 50% bucket 46: 80% bucket 36: 70% bucket 43: 100% Sorting block of length 2617036 for bucket 43 (Using difference cover) bucket 49: 80% bucket 50: 90% bucket 32: 80% bucket 28: 80% bucket 31: 70% bucket 49: 60% Sorting block time: 00:00:03 Returning block of 4269373 for bucket 30 bucket 33: 70% bucket 44: 60% bucket 51: 50% bucket 54: 80% bucket 40: 60% Getting block 58 of 210 Reserving size (4425267) for bucket 58 Calculating Z arrays for bucket 58 Entering block accumulator loop for bucket 58: bucket 42: 100% Sorting block of length 4059091 for bucket 42 (Using difference cover) bucket 45: 100% Sorting block of length 4309234 for bucket 45 (Using difference cover) bucket 39: 60% Sorting block time: 00:00:01 Returning block of 1628638 for bucket 39 bucket 56: 10% bucket 47: 100% Sorting block of length 3069882 for bucket 47 (Using difference cover) Getting block 59 of 210 Reserving size (4425267) for bucket 59 Calculating Z arrays for bucket 59 Entering block accumulator loop for bucket 59: bucket 41: 70% bucket 57: 10% Sorting block time: 00:00:03 Returning block of 3083861 for bucket 38 bucket 53: 50% bucket 48: 100% Sorting block of length 2737687 for bucket 48 (Using difference cover) bucket 50: 100% Sorting block of length 3821307 for bucket 50 (Using difference cover) Getting block 60 of 210 Reserving size (4425267) for bucket 60 Calculating Z arrays for bucket 60 Entering block accumulator loop for bucket 60: bucket 53: 90% Sorting block time: 00:00:02 Returning block of 1532908 for bucket 36 bucket 30: 80% bucket 34: 80% Getting block 61 of 210 Reserving size (4425267) for bucket 61 Calculating Z arrays for bucket 61 Entering block accumulator loop for bucket 61: Sorting block time: 00:00:03 Returning block of 4352731 for bucket 35 bucket 37: 60% bucket 51: 90% bucket 52: 90% Sorting block time: 00:00:02 Returning block of 2126882 for bucket 34 bucket 54: 40% bucket 38: 60% bucket 55: 20% bucket 42: 70% Getting block 62 of 210 Reserving size (4425267) for bucket 62 Calculating Z arrays for bucket 62 Entering block accumulator loop for bucket 62: bucket 46: 60% Getting block 63 of 210 Reserving size (4425267) for bucket 63 Calculating Z arrays for bucket 63 Entering block accumulator loop for bucket 63: bucket 54: 90% bucket 49: 90% Sorting block time: 00:00:02 Returning block of 2899563 for bucket 44 bucket 46: 90% bucket 48: 60% bucket 43: 70% bucket 50: 60% bucket 35: 70% bucket 45: 60% Getting block 64 of 210 Reserving size (4425267) for bucket 64 Calculating Z arrays for bucket 64 Entering block accumulator loop for bucket 64: bucket 59: 10% bucket 52: 50% bucket 29: 100% Sorting block of length 3953277 for bucket 29 (Using difference cover) bucket 32: 90% bucket 49: 70% bucket 58: 10% bucket 39: 70% bucket 33: 80% bucket 28: 90% bucket 36: 80% bucket 41: 80% bucket 47: 60% Sorting block time: 00:00:03 Returning block of 3354937 for bucket 37 bucket 56: 20% bucket 57: 20% bucket 44: 70% bucket 60: 10% bucket 53: 100% Sorting block of length 3756420 for bucket 53 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3072796 for bucket 33 Getting block 65 of 210 Reserving size (4425267) for bucket 65 Calculating Z arrays for bucket 65 Entering block accumulator loop for bucket 65: Sorting block time: 00:00:02 Returning block of 2617037 for bucket 43 bucket 51: 60% bucket 40: 70% Getting block 66 of 210 Reserving size (4425267) for bucket 66 Calculating Z arrays for bucket 66 Entering block accumulator loop for bucket 66: Getting block 67 of 210 Reserving size (4425267) for bucket 67 Calculating Z arrays for bucket 67 Entering block accumulator loop for bucket 67: bucket 31: 80% bucket 62: 10% Sorting block time: 00:00:04 Returning block of 3266248 for bucket 40 bucket 52: 100% Sorting block of length 3743728 for bucket 52 (Using difference cover) bucket 51: 100% Sorting block of length 2180340 for bucket 51 (Using difference cover) Getting block 68 of 210 Reserving size (4425267) for bucket 68 Calculating Z arrays for bucket 68 Entering block accumulator loop for bucket 68: bucket 34: 90% bucket 54: 100% Sorting block of length 3987368 for bucket 54 (Using difference cover) bucket 55: 30% bucket 64: 10% bucket 61: 10% bucket 49: 100% Sorting block of length 4138959 for bucket 49 (Using difference cover) bucket 46: 100% Sorting block of length 2593857 for bucket 46 (Using difference cover) bucket 63: 10% bucket 53: 60% bucket 30: 90% Sorting block time: 00:00:03 Returning block of 3069883 for bucket 47 bucket 46: 70% bucket 52: 60% Getting block 69 of 210 Reserving size (4425267) for bucket 69 Calculating Z arrays for bucket 69 Entering block accumulator loop for bucket 69: bucket 62: 20% bucket 42: 80% Sorting block time: 00:00:02 Returning block of 2737688 for bucket 48 bucket 48: 70% Sorting block time: 00:00:04 Returning block of 4149676 for bucket 32 bucket 58: 20% bucket 37: 70% bucket 50: 70% bucket 59: 20% Getting block 70 of 210 Reserving size (4425267) for bucket 70 Calculating Z arrays for bucket 70 Entering block accumulator loop for bucket 70: bucket 33: 90% bucket 54: 50% bucket 49: 80% bucket 60: 20% Getting block 71 of 210 Reserving size (4425267) for bucket 71 Calculating Z arrays for bucket 71 Entering block accumulator loop for bucket 71: bucket 47: 70% bucket 65: 10% bucket 35: 80% bucket 45: 70% bucket 43: 80% bucket 38: 70% bucket 61: 20% bucket 56: 30% bucket 66: 10% bucket 32: 100% Sorting block of length 4121509 for bucket 32 (Using difference cover) bucket 68: 10% bucket 67: 10% bucket 39: 80% bucket 34: 100% Sorting block of length 3056214 for bucket 34 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3821308 for bucket 50 bucket 36: 90% bucket 57: 30% bucket 64: 20% bucket 41: 90% Getting block 72 of 210 Reserving size (4425267) for bucket 72 Calculating Z arrays for bucket 72 Entering block accumulator loop for bucket 72: bucket 28: 100% Sorting block of length 734050 for bucket 28 (Using difference cover) bucket 40: 80% bucket 62: 30% bucket 44: 80% bucket 55: 40% Sorting block time: 00:00:05 Returning block of 4309235 for bucket 45 bucket 69: 10% bucket 63: 20% Sorting block time: 00:00:02 Returning block of 2180341 for bucket 51 Getting block 73 of 210 Reserving size (4425267) for bucket 73 Calculating Z arrays for bucket 73 Entering block accumulator loop for bucket 73: bucket 31: 90% Sorting block time: 00:00:05 Returning block of 3215428 for bucket 41 Getting block 74 of 210 Reserving size (4425267) for bucket 74 Calculating Z arrays for bucket 74 Entering block accumulator loop for bucket 74: bucket 51: 70% bucket 70: 10% Sorting block time: 00:00:05 Returning block of 4059092 for bucket 42 bucket 68: 20% Sorting block time: 00:00:03 Returning block of 3953278 for bucket 29 Getting block 75 of 210 Reserving size (4425267) for bucket 75 Calculating Z arrays for bucket 75 Entering block accumulator loop for bucket 75: Sorting block time: 00:00:01 Returning block of 734051 for bucket 28 Getting block 55 of 199 Reserving size (4425267) for bucket 55 Calculating Z arrays for bucket 55 Entering block accumulator loop for bucket 55: bucket 58: 30% Getting block 76 of 210 Reserving size (4425267) for bucket 76 Calculating Z arrays for bucket 76 Entering block accumulator loop for bucket 76: bucket 42: 90% bucket 54: 60% Getting block 56 of 199 Reserving size (4425267) for bucket 56 Calculating Z arrays for bucket 56 Entering block accumulator loop for bucket 56: bucket 53: 70% bucket 30: 100% Sorting block of length 3069052 for bucket 30 (Using difference cover) bucket 71: 10% bucket 59: 30% bucket 65: 20% bucket 46: 80% bucket 60: 30% bucket 66: 20% bucket 61: 30% bucket 52: 70% bucket 64: 30% bucket 67: 20% bucket 48: 80% bucket 56: 40% bucket 33: 100% Sorting block of length 4011956 for bucket 33 (Using difference cover) bucket 50: 80% bucket 57: 40% bucket 72: 10% bucket 37: 80% bucket 41: 100% Sorting block of length 3030727 for bucket 41 (Using difference cover) Sorting block time: 00:00:04 Returning block of 3756421 for bucket 53 Sorting block time: 00:00:03 Returning block of 3743729 for bucket 52 Sorting block time: 00:00:03 Returning block of 2593858 for bucket 46 bucket 45: 80% bucket 69: 20% bucket 49: 90% Getting block 77 of 210 Reserving size (4425267) for bucket 77 Calculating Z arrays for bucket 77 Entering block accumulator loop for bucket 77: bucket 62: 40% Getting block 78 of 210 Reserving size (4425267) for bucket 78 Calculating Z arrays for bucket 78 Entering block accumulator loop for bucket 78: Getting block 79 of 210 Reserving size (4425267) for bucket 79 Calculating Z arrays for bucket 79 Entering block accumulator loop for bucket 79: bucket 70: 20% bucket 55: 50% bucket 35: 90% bucket 47: 80% bucket 43: 90% Sorting block time: 00:00:02 Returning block of 3056215 for bucket 34 bucket 73: 10% bucket 74: 10% bucket 63: 30% bucket 68: 30% bucket 38: 80% Getting block 57 of 199 Reserving size (4425267) for bucket 57 Calculating Z arrays for bucket 57 Entering block accumulator loop for bucket 57: Sorting block time: 00:00:03 Returning block of 3987369 for bucket 54 bucket 71: 20% bucket 58: 40% Getting block 80 of 210 Reserving size (4425267) for bucket 80 Calculating Z arrays for bucket 80 Entering block accumulator loop for bucket 80: bucket 39: 90% bucket 75: 10% bucket 36: 100% Sorting block of length 2687000 for bucket 36 (Using difference cover) bucket 55: 10% bucket 65: 30% bucket 69: 30% Sorting block time: 00:00:04 Returning block of 4138960 for bucket 49 bucket 64: 40% bucket 67: 30% bucket 76: 10% bucket 66: 30% bucket 70: 30% bucket 59: 40% bucket 40: 90% bucket 60: 40% Getting block 81 of 210 Reserving size (4425267) for bucket 81 Calculating Z arrays for bucket 81 Entering block accumulator loop for bucket 81: bucket 42: 100% Sorting block of length 4061886 for bucket 42 (Using difference cover) bucket 31: 100% Sorting block of length 4304865 for bucket 31 (Using difference cover) bucket 72: 20% bucket 61: 40% bucket 44: 90% Sorting block time: 00:00:03 Returning block of 4121510 for bucket 32 bucket 57: 50% bucket 56: 50% bucket 48: 90% bucket 53: 80% bucket 51: 80% bucket 73: 20% Getting block 58 of 199 Reserving size (4425267) for bucket 58 Calculating Z arrays for bucket 58 Entering block accumulator loop for bucket 58: bucket 54: 70% bucket 79: 10% bucket 77: 10% bucket 78: 10% bucket 62: 50% bucket 74: 20% bucket 56: 10% bucket 68: 40% bucket 55: 60% bucket 46: 90% bucket 50: 90% bucket 71: 30% Sorting block time: 00:00:03 Returning block of 3069053 for bucket 30 bucket 63: 40% bucket 37: 90% bucket 45: 90% Getting block 59 of 199 Reserving size (4425267) for bucket 59 Calculating Z arrays for bucket 59 Entering block accumulator loop for bucket 59: bucket 80: 10% bucket 69: 40% bucket 52: 80% bucket 64: 50% bucket 75: 20% Sorting block time: 00:00:02 Returning block of 3030728 for bucket 41 bucket 65: 40% bucket 58: 50% bucket 38: 90% bucket 67: 40% bucket 70: 40% Getting block 60 of 199 Reserving size (4425267) for bucket 60 Calculating Z arrays for bucket 60 Entering block accumulator loop for bucket 60: bucket 66: 40% Sorting block time: 00:00:02 Returning block of 4011957 for bucket 33 bucket 49: 100% Sorting block of length 3564095 for bucket 49 (Using difference cover) bucket 35: 100% Sorting block of length 2142328 for bucket 35 (Using difference cover) bucket 57: 10% bucket 43: 100% Sorting block of length 3590714 for bucket 43 (Using difference cover) bucket 73: 30% Sorting block time: 00:00:02 Returning block of 2687001 for bucket 36 Getting block 61 of 199 Reserving size (4425267) for bucket 61 Calculating Z arrays for bucket 61 Entering block accumulator loop for bucket 61: bucket 59: 50% bucket 55: 20% bucket 60: 50% bucket 72: 30% Getting block 62 of 199 Reserving size (4425267) for bucket 62 Calculating Z arrays for bucket 62 Entering block accumulator loop for bucket 62: bucket 47: 90% bucket 76: 20% bucket 81: 10% bucket 79: 20% bucket 77: 20% bucket 57: 60% bucket 61: 50% bucket 78: 20% bucket 56: 60% bucket 68: 50% bucket 40: 100% Sorting block of length 4129927 for bucket 40 (Using difference cover) bucket 58: 10% bucket 74: 30% bucket 44: 100% Sorting block of length 4397138 for bucket 44 (Using difference cover) bucket 80: 20% bucket 39: 100% Sorting block of length 4144151 for bucket 39 (Using difference cover) bucket 62: 60% bucket 55: 70% bucket 69: 50% bucket 71: 40% bucket 48: 100% Sorting block of length 2610805 for bucket 48 (Using difference cover) bucket 64: 60% bucket 54: 80% bucket 63: 50% bucket 65: 50% bucket 73: 40% bucket 46: 100% Sorting block of length 3435307 for bucket 46 (Using difference cover) bucket 70: 50% bucket 67: 50% bucket 58: 60% bucket 75: 30% bucket 51: 90% bucket 53: 90% bucket 56: 20% bucket 66: 50% bucket 78: 30% bucket 50: 100% Sorting block of length 3456550 for bucket 50 (Using difference cover) bucket 72: 40% bucket 59: 10% bucket 45: 100% Sorting block of length 3568093 for bucket 45 (Using difference cover) bucket 59: 60% bucket 79: 30% bucket 60: 60% bucket 76: 30% bucket 81: 20% bucket 37: 100% Sorting block of length 3552065 for bucket 37 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2142329 for bucket 35 bucket 68: 60% bucket 77: 30% Sorting block time: 00:00:03 Returning block of 4061887 for bucket 42 bucket 80: 30% Getting block 63 of 199 Reserving size (4425267) for bucket 63 Calculating Z arrays for bucket 63 Entering block accumulator loop for bucket 63: bucket 60: 10% bucket 57: 70% bucket 70: 60% Getting block 64 of 199 Reserving size (4425267) for bucket 64 Calculating Z arrays for bucket 64 Entering block accumulator loop for bucket 64: bucket 56: 70% bucket 74: 40% bucket 61: 10% bucket 52: 90% bucket 64: 70% bucket 38: 100% Sorting block of length 1808289 for bucket 38 (Using difference cover) bucket 78: 40% bucket 62: 70% bucket 69: 60% bucket 61: 60% bucket 57: 20% bucket 55: 80% bucket 62: 10% bucket 73: 50% Sorting block time: 00:00:03 Returning block of 3590715 for bucket 43 bucket 47: 100% Sorting block of length 2985386 for bucket 47 (Using difference cover) Getting block 65 of 199 Reserving size (4425267) for bucket 65 Calculating Z arrays for bucket 65 Entering block accumulator loop for bucket 65: bucket 71: 50% bucket 65: 60% bucket 68: 70% bucket 63: 60% bucket 67: 60% bucket 58: 20% bucket 77: 40% bucket 72: 50% bucket 66: 60% bucket 54: 90% bucket 58: 70% Sorting block time: 00:00:05 Returning block of 4304866 for bucket 31 Sorting block time: 00:00:04 Returning block of 3564096 for bucket 49 bucket 55: 30% bucket 79: 40% bucket 75: 40% bucket 70: 70% Getting block 66 of 199 Reserving size (4425267) for bucket 66 Calculating Z arrays for bucket 66 Entering block accumulator loop for bucket 66: Getting block 67 of 199 Reserving size (4425267) for bucket 67 Calculating Z arrays for bucket 67 Entering block accumulator loop for bucket 67: bucket 60: 70% bucket 78: 50% bucket 80: 40% bucket 53: 100% Sorting block of length 4029715 for bucket 53 (Using difference cover) bucket 81: 30% Sorting block time: 00:00:03 Returning block of 2610806 for bucket 48 bucket 59: 70% Getting block 68 of 199 Reserving size (4425267) for bucket 68 Calculating Z arrays for bucket 68 Entering block accumulator loop for bucket 68: bucket 56: 30% bucket 64: 80% bucket 51: 100% Sorting block of length 4271040 for bucket 51 (Using difference cover) bucket 74: 50% bucket 76: 40% bucket 69: 70% bucket 57: 80% Sorting block time: 00:00:01 Returning block of 1808290 for bucket 38 bucket 56: 80% bucket 61: 20% bucket 73: 60% bucket 59: 20% bucket 62: 80% bucket 63: 70% bucket 60: 20% bucket 77: 50% bucket 55: 90% bucket 61: 70% bucket 68: 80% bucket 67: 70% bucket 65: 70% bucket 70: 80% bucket 60: 80% bucket 71: 60% Getting block 69 of 199 Reserving size (4425267) for bucket 69 Calculating Z arrays for bucket 69 Entering block accumulator loop for bucket 69: bucket 66: 70% bucket 64: 10% bucket 63: 10% bucket 72: 60% bucket 57: 30% Sorting block time: 00:00:03 Returning block of 3435308 for bucket 46 bucket 52: 100% Sorting block of length 3711102 for bucket 52 (Using difference cover) bucket 78: 60% bucket 79: 50% bucket 69: 80% Sorting block time: 00:00:04 Returning block of 4144152 for bucket 39 bucket 62: 20% bucket 58: 80% bucket 75: 50% bucket 80: 50% bucket 65: 10% bucket 81: 40% bucket 54: 100% Sorting block of length 4339284 for bucket 54 (Using difference cover) Getting block 70 of 199 Reserving size (4425267) for bucket 70 Calculating Z arrays for bucket 70 Entering block accumulator loop for bucket 70: bucket 74: 60% Sorting block time: 00:00:03 Returning block of 3552066 for bucket 37 Sorting block time: 00:00:04 Returning block of 4129928 for bucket 40 Getting block 71 of 199 Reserving size (4425267) for bucket 71 Calculating Z arrays for bucket 71 Entering block accumulator loop for bucket 71: Sorting block time: 00:00:03 Returning block of 3456551 for bucket 50 bucket 58: 30% Sorting block time: 00:00:03 Returning block of 3568094 for bucket 45 Sorting block time: 00:00:04 Returning block of 4397139 for bucket 44 Getting block 72 of 199 Reserving size (4425267) for bucket 72 Calculating Z arrays for bucket 72 Entering block accumulator loop for bucket 72: bucket 64: 90% Getting block 73 of 199 Reserving size (4425267) for bucket 73 Calculating Z arrays for bucket 73 Entering block accumulator loop for bucket 73: Getting block 74 of 199 Reserving size (4425267) for bucket 74 Calculating Z arrays for bucket 74 Entering block accumulator loop for bucket 74: bucket 55: 40% bucket 59: 80% Getting block 75 of 199 Reserving size (4425267) for bucket 75 Calculating Z arrays for bucket 75 Entering block accumulator loop for bucket 75: bucket 55: 100% Sorting block of length 2472384 for bucket 55 (Using difference cover) Getting block 76 of 199 Reserving size (4425267) for bucket 76 Calculating Z arrays for bucket 76 Entering block accumulator loop for bucket 76: bucket 56: 40% bucket 76: 50% bucket 67: 80% bucket 63: 80% Sorting block time: 00:00:03 Returning block of 2985387 for bucket 47 bucket 66: 10% Getting block 77 of 199 Reserving size (4425267) for bucket 77 Calculating Z arrays for bucket 77 Entering block accumulator loop for bucket 77: bucket 68: 90% bucket 77: 60% bucket 70: 90% bucket 65: 80% bucket 73: 70% bucket 68: 10% bucket 67: 10% bucket 74: 70% bucket 72: 70% bucket 71: 70% bucket 78: 70% bucket 79: 60% bucket 62: 90% bucket 56: 90% bucket 60: 90% bucket 57: 40% bucket 69: 90% bucket 66: 80% bucket 61: 30% bucket 80: 60% bucket 61: 80% bucket 57: 90% bucket 60: 30% bucket 81: 50% bucket 75: 60% bucket 59: 90% bucket 58: 90% bucket 64: 100% Sorting block of length 4397434 for bucket 64 (Using difference cover) bucket 59: 30% bucket 64: 20% Sorting block time: 00:00:03 Returning block of 4029716 for bucket 53 bucket 67: 90% bucket 63: 90% Getting block 78 of 199 Reserving size (4425267) for bucket 78 Calculating Z arrays for bucket 78 Entering block accumulator loop for bucket 78: bucket 65: 20% bucket 62: 100% Sorting block of length 3020881 for bucket 62 (Using difference cover) bucket 68: 100% Sorting block of length 2459351 for bucket 68 (Using difference cover) bucket 76: 60% bucket 69: 10% bucket 70: 100% Sorting block of length 2953572 for bucket 70 (Using difference cover) bucket 62: 30% bucket 77: 70% bucket 63: 20% bucket 65: 90% bucket 73: 80% bucket 71: 10% bucket 79: 70% bucket 74: 80% bucket 72: 80% bucket 78: 80% bucket 69: 100% Sorting block of length 4190769 for bucket 69 (Using difference cover) bucket 72: 10% bucket 71: 80% bucket 55: 50% bucket 75: 10% bucket 70: 10% Sorting block time: 00:00:04 Returning block of 4271041 for bucket 51 bucket 80: 70% bucket 56: 50% bucket 66: 90% bucket 60: 100% Sorting block of length 3588212 for bucket 60 (Using difference cover) bucket 56: 100% Sorting block of length 3260754 for bucket 56 (Using difference cover) bucket 58: 40% bucket 81: 60% bucket 57: 100% Sorting block of length 2298365 for bucket 57 (Using difference cover) Getting block 79 of 199 Reserving size (4425267) for bucket 79 Calculating Z arrays for bucket 79 Entering block accumulator loop for bucket 79: bucket 74: 10% Sorting block time: 00:00:02 Returning block of 2472385 for bucket 55 bucket 57: 50% bucket 61: 90% bucket 73: 10% bucket 66: 20% bucket 75: 70% bucket 58: 100% Sorting block of length 4164238 for bucket 58 (Using difference cover) Getting block 82 of 210 Reserving size (4425267) for bucket 82 Calculating Z arrays for bucket 82 Entering block accumulator loop for bucket 82: Sorting block time: 00:00:03 Returning block of 3711103 for bucket 52 bucket 59: 100% Sorting block of length 4126827 for bucket 59 (Using difference cover) bucket 77: 10% bucket 76: 10% Getting block 80 of 199 Reserving size (4425267) for bucket 80 Calculating Z arrays for bucket 80 Entering block accumulator loop for bucket 80: bucket 67: 100% Sorting block of length 3528562 for bucket 67 (Using difference cover) bucket 72: 90% bucket 73: 90% bucket 79: 80% bucket 63: 100% Sorting block of length 2393304 for bucket 63 (Using difference cover) bucket 67: 20% Sorting block time: 00:00:04 Returning block of 4339285 for bucket 54 bucket 77: 80% bucket 61: 40% bucket 65: 100% Sorting block of length 3567656 for bucket 65 (Using difference cover) Getting block 81 of 199 Reserving size (4425267) for bucket 81 Calculating Z arrays for bucket 81 Entering block accumulator loop for bucket 81: bucket 68: 20% bucket 74: 90% bucket 76: 70% bucket 78: 90% bucket 60: 40% bucket 80: 80% bucket 78: 10% bucket 64: 30% bucket 59: 40% bucket 71: 90% bucket 66: 100% Sorting block of length 2833128 for bucket 66 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2953573 for bucket 70 bucket 81: 70% bucket 71: 20% Getting block 83 of 210 Reserving size (4425267) for bucket 83 Calculating Z arrays for bucket 83 Entering block accumulator loop for bucket 83: bucket 82: 10% bucket 72: 100% Sorting block of length 3731882 for bucket 72 (Using difference cover) bucket 61: 100% Sorting block of length 2581252 for bucket 61 (Using difference cover) bucket 75: 80% bucket 63: 30% bucket 62: 40% bucket 72: 20% bucket 79: 90% bucket 65: 30% bucket 55: 60% bucket 73: 100% Sorting block of length 3531447 for bucket 73 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4397435 for bucket 64 bucket 66: 30% bucket 79: 10% bucket 75: 20% bucket 56: 60% bucket 58: 50% bucket 77: 90% Getting block 84 of 210 Reserving size (4425267) for bucket 84 Calculating Z arrays for bucket 84 Entering block accumulator loop for bucket 84: Sorting block time: 00:00:03 Returning block of 3020882 for bucket 62 bucket 57: 60% Sorting block time: 00:00:02 Returning block of 2298366 for bucket 57 bucket 80: 10% Getting block 85 of 210 Reserving size (4425267) for bucket 85 Calculating Z arrays for bucket 85 Entering block accumulator loop for bucket 85: bucket 69: 20% bucket 74: 100% Sorting block of length 3529549 for bucket 74 (Using difference cover) Getting block 86 of 210 Reserving size (4425267) for bucket 86 Calculating Z arrays for bucket 86 Entering block accumulator loop for bucket 86: bucket 74: 20% bucket 77: 20% bucket 80: 90% bucket 78: 100% Sorting block of length 4047233 for bucket 78 (Using difference cover) bucket 76: 80% bucket 61: 50% bucket 81: 80% bucket 70: 20% bucket 83: 10% bucket 60: 50% bucket 71: 100% Sorting block of length 3242254 for bucket 71 (Using difference cover) Sorting block time: 00:00:04 Returning block of 2459352 for bucket 68 bucket 73: 20% Getting block 87 of 210 Reserving size (4425267) for bucket 87 Calculating Z arrays for bucket 87 Entering block accumulator loop for bucket 87: bucket 67: 30% Sorting block time: 00:00:03 Returning block of 4190770 for bucket 69 Sorting block time: 00:00:03 Returning block of 3260755 for bucket 56 bucket 81: 10% bucket 66: 40% bucket 82: 20% bucket 68: 30% bucket 79: 100% Sorting block of length 2339042 for bucket 79 (Using difference cover) bucket 76: 20% bucket 75: 90% Sorting block time: 00:00:03 Returning block of 3528563 for bucket 67 bucket 78: 20% Sorting block time: 00:00:03 Returning block of 3588213 for bucket 60 Getting block 88 of 210 Reserving size (4425267) for bucket 88 Calculating Z arrays for bucket 88 Entering block accumulator loop for bucket 88: Getting block 89 of 210 Reserving size (4425267) for bucket 89 Calculating Z arrays for bucket 89 Entering block accumulator loop for bucket 89: bucket 63: 40% bucket 64: 40% Getting block 90 of 210 Reserving size (4425267) for bucket 90 Calculating Z arrays for bucket 90 Entering block accumulator loop for bucket 90: Getting block 91 of 210 Reserving size (4425267) for bucket 91 Calculating Z arrays for bucket 91 Entering block accumulator loop for bucket 91: bucket 71: 30% bucket 77: 100% Sorting block of length 2076820 for bucket 77 (Using difference cover) bucket 59: 50% bucket 84: 10% Sorting block time: 00:00:03 Returning block of 2393305 for bucket 63 Sorting block time: 00:00:03 Returning block of 3567657 for bucket 65 bucket 85: 10% Getting block 92 of 210 Reserving size (4425267) for bucket 92 Calculating Z arrays for bucket 92 Entering block accumulator loop for bucket 92: bucket 62: 50% bucket 83: 20% Getting block 93 of 210 Reserving size (4425267) for bucket 93 Calculating Z arrays for bucket 93 Entering block accumulator loop for bucket 93: bucket 80: 100% Sorting block of length 2440999 for bucket 80 (Using difference cover) Sorting block time: 00:00:04 Returning block of 4126828 for bucket 59 Sorting block time: 00:00:03 Returning block of 2833129 for bucket 66 bucket 72: 30% bucket 76: 90% Sorting block time: 00:00:04 Returning block of 4164239 for bucket 58 bucket 86: 10% Getting block 94 of 210 Reserving size (4425267) for bucket 94 Calculating Z arrays for bucket 94 Entering block accumulator loop for bucket 94: Sorting block time: 00:00:02 Returning block of 3731883 for bucket 72 Getting block 95 of 210 Reserving size (4425267) for bucket 95 Calculating Z arrays for bucket 95 Entering block accumulator loop for bucket 95: bucket 81: 90% Getting block 96 of 210 Reserving size (4425267) for bucket 96 Calculating Z arrays for bucket 96 Entering block accumulator loop for bucket 96: bucket 57: 70% Getting block 97 of 210 Reserving size (4425267) for bucket 97 Calculating Z arrays for bucket 97 Entering block accumulator loop for bucket 97: bucket 80: 20% bucket 58: 60% bucket 84: 20% bucket 55: 70% bucket 65: 40% bucket 91: 10% bucket 61: 60% Sorting block time: 00:00:03 Returning block of 3531448 for bucket 73 bucket 75: 30% bucket 87: 10% Sorting block time: 00:00:03 Returning block of 2581253 for bucket 61 bucket 82: 30% bucket 56: 70% Getting block 98 of 210 Reserving size (4425267) for bucket 98 Calculating Z arrays for bucket 98 Entering block accumulator loop for bucket 98: bucket 88: 10% Getting block 99 of 210 Reserving size (4425267) for bucket 99 Calculating Z arrays for bucket 99 Entering block accumulator loop for bucket 99: bucket 89: 10% bucket 83: 30% bucket 75: 100% Sorting block of length 1399802 for bucket 75 (Using difference cover) bucket 79: 20% Sorting block time: 00:00:02 Returning block of 2339043 for bucket 79 bucket 77: 30% bucket 90: 10% Getting block 100 of 210 Reserving size (4425267) for bucket 100 Calculating Z arrays for bucket 100 Entering block accumulator loop for bucket 100: bucket 74: 30% bucket 69: 30% bucket 85: 20% Sorting block time: 00:00:02 Returning block of 3242255 for bucket 71 bucket 60: 60% bucket 67: 40% Sorting block time: 00:00:01 Returning block of 2076821 for bucket 77 bucket 92: 10% Getting block 101 of 210 Reserving size (4425267) for bucket 101 Calculating Z arrays for bucket 101 Entering block accumulator loop for bucket 101: Sorting block time: 00:00:01 Returning block of 2441000 for bucket 80 bucket 78: 30% bucket 84: 30% bucket 93: 10% Sorting block time: 00:00:03 Returning block of 3529550 for bucket 74 Getting block 102 of 210 Reserving size (4425267) for bucket 102 Calculating Z arrays for bucket 102 Entering block accumulator loop for bucket 102: bucket 59: 60% Getting block 103 of 210 Reserving size (4425267) for bucket 103 Calculating Z arrays for bucket 103 Entering block accumulator loop for bucket 103: bucket 66: 50% bucket 70: 30% bucket 68: 40% bucket 64: 50% bucket 81: 20% Getting block 104 of 210 Reserving size (4425267) for bucket 104 Calculating Z arrays for bucket 104 Entering block accumulator loop for bucket 104: bucket 86: 20% bucket 63: 50% bucket 76: 100% Sorting block of length 4100760 for bucket 76 (Using difference cover) bucket 91: 20% bucket 76: 30% bucket 94: 10% Sorting block time: 00:00:03 Returning block of 4047234 for bucket 78 bucket 95: 10% bucket 81: 100% Sorting block of length 2554188 for bucket 81 (Using difference cover) bucket 73: 30% bucket 97: 10% bucket 62: 60% Getting block 105 of 210 Reserving size (4425267) for bucket 105 Calculating Z arrays for bucket 105 Entering block accumulator loop for bucket 105: bucket 58: 70% bucket 96: 10% bucket 82: 40% bucket 84: 40% bucket 87: 20% bucket 83: 40% bucket 88: 20% bucket 57: 80% Sorting block time: 00:00:01 Returning block of 1399803 for bucket 75 bucket 101: 10% bucket 71: 40% bucket 99: 10% Getting block 106 of 210 Reserving size (4425267) for bucket 106 Calculating Z arrays for bucket 106 Entering block accumulator loop for bucket 106: bucket 98: 10% bucket 90: 20% bucket 100: 10% bucket 85: 30% bucket 75: 40% bucket 56: 80% bucket 89: 20% bucket 80: 30% bucket 72: 40% bucket 65: 50% bucket 61: 70% bucket 92: 20% bucket 102: 10% bucket 83: 50% bucket 93: 20% bucket 103: 10% bucket 55: 80% bucket 104: 10% bucket 86: 30% bucket 97: 20% bucket 91: 30% bucket 78: 40% bucket 77: 40% bucket 60: 70% bucket 74: 40% bucket 94: 20% bucket 95: 20% bucket 84: 50% bucket 82: 50% bucket 62: 70% bucket 81: 30% Sorting block time: 00:00:02 Returning block of 2554189 for bucket 81 bucket 67: 50% bucket 79: 30% bucket 96: 20% bucket 99: 20% bucket 87: 30% bucket 101: 20% Getting block 107 of 210 Reserving size (4425267) for bucket 107 Calculating Z arrays for bucket 107 Entering block accumulator loop for bucket 107: bucket 105: 10% bucket 64: 60% bucket 68: 50% bucket 88: 30% bucket 59: 70% bucket 70: 40% bucket 69: 40% bucket 66: 60% bucket 58: 80% bucket 85: 40% bucket 80: 40% bucket 63: 60% bucket 100: 20% bucket 90: 30% bucket 83: 60% bucket 61: 80% bucket 73: 40% bucket 92: 30% bucket 89: 30% bucket 84: 60% bucket 98: 20% bucket 106: 10% bucket 93: 30% bucket 102: 20% bucket 76: 40% bucket 86: 40% bucket 57: 90% bucket 72: 50% bucket 97: 30% bucket 91: 40% bucket 104: 20% bucket 103: 20% bucket 75: 50% bucket 95: 30% bucket 82: 60% bucket 94: 30% bucket 71: 50% bucket 79: 40% bucket 64: 70% bucket 87: 40% bucket 96: 30% bucket 88: 40% bucket 99: 30% bucket 78: 50% bucket 101: 30% bucket 81: 40% bucket 84: 70% bucket 85: 50% Sorting block time: 00:00:04 Returning block of 4100761 for bucket 76 bucket 60: 80% bucket 62: 80% bucket 107: 10% bucket 56: 90% bucket 83: 70% bucket 77: 50% bucket 100: 30% bucket 74: 50% bucket 105: 20% bucket 65: 60% bucket 90: 40% Getting block 108 of 210 Reserving size (4425267) for bucket 108 Calculating Z arrays for bucket 108 Entering block accumulator loop for bucket 108: bucket 55: 90% bucket 68: 60% bucket 66: 70% bucket 80: 50% bucket 92: 40% bucket 67: 60% bucket 93: 40% bucket 89: 40% bucket 86: 50% bucket 70: 50% bucket 98: 30% bucket 102: 30% bucket 97: 40% bucket 63: 70% bucket 91: 50% bucket 82: 70% bucket 58: 90% bucket 104: 30% bucket 103: 30% bucket 59: 80% bucket 95: 40% bucket 106: 20% bucket 71: 60% bucket 57: 100% Sorting block of length 49487 for bucket 57 (Using difference cover) bucket 94: 40% Sorting block time: 00:00:00 Returning block of 49488 for bucket 57 Getting block 82 of 199 Reserving size (4425267) for bucket 82 Calculating Z arrays for bucket 82 Entering block accumulator loop for bucket 82: bucket 61: 90% bucket 84: 80% bucket 64: 80% bucket 88: 50% bucket 87: 50% bucket 69: 50% bucket 99: 40% bucket 96: 40% bucket 85: 60% bucket 76: 50% bucket 83: 80% bucket 101: 40% bucket 73: 50% bucket 100: 40% bucket 62: 90% bucket 81: 50% bucket 90: 50% bucket 79: 50% bucket 78: 60% bucket 107: 20% bucket 105: 30% bucket 72: 60% bucket 56: 100% Sorting block of length 5755267 for bucket 56 (Using difference cover) bucket 68: 70% bucket 92: 50% bucket 86: 60% bucket 108: 10% bucket 89: 50% bucket 65: 70% bucket 97: 50% bucket 93: 50% bucket 60: 90% bucket 102: 40% bucket 82: 80% bucket 87: 60% bucket 98: 40% bucket 66: 80% bucket 91: 60% bucket 75: 60% bucket 61: 100% Sorting block of length 2729078 for bucket 61 (Using difference cover) bucket 95: 50% bucket 83: 90% bucket 103: 40% bucket 74: 60% bucket 84: 90% bucket 104: 40% bucket 94: 50% bucket 88: 60% bucket 55: 100% Sorting block of length 2505245 for bucket 55 (Using difference cover) bucket 85: 70% bucket 96: 50% bucket 77: 60% bucket 99: 50% bucket 82: 10% bucket 67: 70% bucket 80: 60% bucket 58: 100% Sorting block of length 4065942 for bucket 58 (Using difference cover) bucket 101: 50% bucket 106: 30% bucket 63: 80% bucket 100: 50% bucket 64: 90% bucket 90: 60% bucket 59: 90% bucket 107: 30% bucket 70: 60% bucket 86: 70% bucket 62: 100% Sorting block of length 3709160 for bucket 62 (Using difference cover) bucket 97: 60% bucket 105: 40% bucket 85: 80% bucket 71: 70% bucket 89: 60% bucket 87: 70% bucket 92: 60% bucket 82: 90% bucket 69: 60% bucket 108: 20% bucket 102: 50% bucket 83: 100% Sorting block of length 2979631 for bucket 83 (Using difference cover) bucket 60: 100% Sorting block of length 1930992 for bucket 60 (Using difference cover) bucket 84: 100% Sorting block of length 2364668 for bucket 84 (Using difference cover) bucket 93: 60% bucket 91: 70% bucket 95: 60% bucket 98: 50% bucket 99: 60% bucket 88: 70% bucket 78: 70% bucket 94: 60% bucket 103: 50% bucket 104: 50% bucket 96: 60% bucket 79: 60% bucket 73: 60% bucket 81: 60% bucket 76: 60% bucket 68: 80% bucket 72: 70% bucket 101: 60% Sorting block time: 00:00:02 Returning block of 2729079 for bucket 61 bucket 80: 70% bucket 66: 90% bucket 100: 60% Getting block 83 of 199 Reserving size (4425267) for bucket 83 Calculating Z arrays for bucket 83 Entering block accumulator loop for bucket 83: bucket 97: 70% bucket 90: 70% Sorting block time: 00:00:03 Returning block of 2505246 for bucket 55 bucket 65: 80% bucket 74: 70% bucket 107: 40% Getting block 84 of 199 Reserving size (4425267) for bucket 84 Calculating Z arrays for bucket 84 Entering block accumulator loop for bucket 84: bucket 86: 80% bucket 85: 90% bucket 82: 100% Sorting block of length 4383280 for bucket 82 (Using difference cover) bucket 92: 70% Sorting block time: 00:00:01 Returning block of 1930993 for bucket 60 bucket 87: 80% bucket 106: 40% bucket 89: 70% Getting block 85 of 199 Reserving size (4425267) for bucket 85 Calculating Z arrays for bucket 85 Entering block accumulator loop for bucket 85: bucket 105: 50% bucket 99: 70% bucket 108: 30% bucket 64: 100% Sorting block of length 2839860 for bucket 64 (Using difference cover) bucket 102: 60% bucket 82: 20% bucket 95: 70% bucket 75: 70% Sorting block time: 00:00:01 Returning block of 2979632 for bucket 83 bucket 91: 80% bucket 67: 80% bucket 88: 80% bucket 93: 70% bucket 71: 80% bucket 98: 60% bucket 94: 70% Getting block 109 of 210 Reserving size (4425267) for bucket 109 Calculating Z arrays for bucket 109 Entering block accumulator loop for bucket 109: bucket 96: 70% Sorting block time: 00:00:01 Returning block of 2364669 for bucket 84 bucket 103: 60% bucket 104: 60% Getting block 110 of 210 Reserving size (4425267) for bucket 110 Calculating Z arrays for bucket 110 Entering block accumulator loop for bucket 110: bucket 63: 90% bucket 77: 70% bucket 80: 80% bucket 85: 100% Sorting block of length 3762607 for bucket 85 (Using difference cover) bucket 70: 70% bucket 101: 70% bucket 59: 100% Sorting block of length 4288259 for bucket 59 (Using difference cover) bucket 100: 70% bucket 69: 70% bucket 97: 80% bucket 78: 80% bucket 86: 90% bucket 90: 80% bucket 79: 70% Sorting block time: 00:00:03 Returning block of 3709161 for bucket 62 bucket 81: 70% Sorting block time: 00:00:03 Returning block of 4065943 for bucket 58 bucket 107: 50% bucket 65: 90% bucket 110: 10% Getting block 86 of 199 Reserving size (4425267) for bucket 86 Calculating Z arrays for bucket 86 Entering block accumulator loop for bucket 86: bucket 87: 90% bucket 68: 90% bucket 83: 10% Getting block 87 of 199 Reserving size (4425267) for bucket 87 Calculating Z arrays for bucket 87 Entering block accumulator loop for bucket 87: bucket 89: 80% bucket 92: 80% bucket 99: 80% Sorting block time: 00:00:05 Returning block of 5755268 for bucket 56 bucket 102: 70% bucket 76: 70% bucket 95: 80% bucket 88: 90% bucket 66: 100% Sorting block of length 4094606 for bucket 66 (Using difference cover) bucket 108: 40% Sorting block time: 00:00:02 Returning block of 2839861 for bucket 64 bucket 105: 60% bucket 74: 80% bucket 91: 90% Getting block 88 of 199 Reserving size (4425267) for bucket 88 Calculating Z arrays for bucket 88 Entering block accumulator loop for bucket 88: bucket 96: 80% Getting block 89 of 199 Reserving size (4425267) for bucket 89 Calculating Z arrays for bucket 89 Entering block accumulator loop for bucket 89: bucket 94: 80% bucket 98: 70% bucket 109: 10% bucket 72: 80% bucket 106: 50% bucket 103: 70% bucket 93: 80% bucket 104: 70% bucket 73: 70% bucket 110: 20% bucket 85: 10% bucket 75: 80% bucket 97: 90% bucket 100: 80% bucket 84: 10% bucket 101: 80% bucket 86: 100% Sorting block of length 2076263 for bucket 86 (Using difference cover) bucket 82: 30% bucket 71: 90% bucket 90: 90% bucket 87: 100% Sorting block of length 3901522 for bucket 87 (Using difference cover) bucket 67: 90% bucket 81: 80% bucket 63: 100% Sorting block of length 4030239 for bucket 63 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4383281 for bucket 82 bucket 102: 80% bucket 108: 50% bucket 107: 60% bucket 99: 90% bucket 80: 90% bucket 92: 90% Getting block 111 of 210 Reserving size (4425267) for bucket 111 Calculating Z arrays for bucket 111 Entering block accumulator loop for bucket 111: bucket 88: 100% Sorting block of length 1981400 for bucket 88 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3762608 for bucket 85 bucket 109: 20% bucket 95: 90% bucket 70: 80% bucket 77: 80% bucket 89: 90% bucket 97: 100% Sorting block of length 3260935 for bucket 97 (Using difference cover) bucket 65: 100% Sorting block of length 3180766 for bucket 65 (Using difference cover) bucket 91: 100% Sorting block of length 3876032 for bucket 91 (Using difference cover) bucket 96: 90% Getting block 112 of 210 Reserving size (4425267) for bucket 112 Calculating Z arrays for bucket 112 Entering block accumulator loop for bucket 112: bucket 68: 100% Sorting block of length 4192255 for bucket 68 (Using difference cover) bucket 98: 80% bucket 94: 90% bucket 86: 10% bucket 105: 70% bucket 103: 80% bucket 104: 80% bucket 110: 30% bucket 78: 90% bucket 83: 20% bucket 93: 90% bucket 69: 80% bucket 74: 90% bucket 106: 60% bucket 87: 10% bucket 100: 90% bucket 108: 60% Sorting block time: 00:00:03 Returning block of 4288260 for bucket 59 bucket 101: 90% bucket 79: 80% bucket 76: 80% bucket 89: 10% bucket 90: 100% Sorting block of length 1983823 for bucket 90 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2076264 for bucket 86 Getting block 90 of 199 Reserving size (4425267) for bucket 90 Calculating Z arrays for bucket 90 Entering block accumulator loop for bucket 90: bucket 85: 20% bucket 99: 100% Sorting block of length 3117707 for bucket 99 (Using difference cover) Getting block 113 of 210 Reserving size (4425267) for bucket 113 Calculating Z arrays for bucket 113 Entering block accumulator loop for bucket 113: bucket 84: 20% bucket 109: 30% bucket 73: 80% bucket 102: 90% bucket 107: 70% bucket 92: 100% Sorting block of length 2711363 for bucket 92 (Using difference cover) bucket 95: 100% Sorting block of length 4385615 for bucket 95 (Using difference cover) Sorting block time: 00:00:02 Returning block of 1981401 for bucket 88 bucket 72: 90% bucket 80: 100% Sorting block of length 4327292 for bucket 80 (Using difference cover) bucket 71: 100% Sorting block of length 3976393 for bucket 71 (Using difference cover) Getting block 114 of 210 Reserving size (4425267) for bucket 114 Calculating Z arrays for bucket 114 Entering block accumulator loop for bucket 114: bucket 112: 10% bucket 89: 100% Sorting block of length 4000954 for bucket 89 (Using difference cover) bucket 75: 90% bucket 88: 10% bucket 82: 40% bucket 96: 100% Sorting block of length 1476600 for bucket 96 (Using difference cover) bucket 111: 10% bucket 81: 90% bucket 98: 90% bucket 94: 100% Sorting block of length 3345215 for bucket 94 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4094607 for bucket 66 bucket 67: 100% Sorting block of length 3750129 for bucket 67 (Using difference cover) bucket 103: 90% bucket 110: 40% bucket 104: 90% Getting block 91 of 199 Reserving size (4425267) for bucket 91 Calculating Z arrays for bucket 91 Entering block accumulator loop for bucket 91: bucket 93: 100% Sorting block of length 4316669 for bucket 93 (Using difference cover) bucket 105: 80% bucket 100: 100% Sorting block of length 3860306 for bucket 100 (Using difference cover) bucket 108: 70% bucket 86: 20% bucket 101: 100% Sorting block of length 3640302 for bucket 101 (Using difference cover) bucket 106: 70% bucket 78: 100% Sorting block of length 2890371 for bucket 78 (Using difference cover) bucket 112: 20% Sorting block time: 00:00:03 Returning block of 3180767 for bucket 65 bucket 102: 100% Sorting block of length 1536279 for bucket 102 (Using difference cover) bucket 113: 10% Sorting block time: 00:00:03 Returning block of 3260936 for bucket 97 bucket 89: 20% Getting block 92 of 199 Reserving size (4425267) for bucket 92 Calculating Z arrays for bucket 92 Entering block accumulator loop for bucket 92: Getting block 115 of 210 Reserving size (4425267) for bucket 115 Calculating Z arrays for bucket 115 Entering block accumulator loop for bucket 115: bucket 109: 40% bucket 77: 90% bucket 83: 30% Sorting block time: 00:00:03 Returning block of 3901523 for bucket 87 bucket 70: 90% bucket 74: 100% Sorting block of length 3520538 for bucket 74 (Using difference cover) Sorting block time: 00:00:02 Returning block of 1983824 for bucket 90 bucket 87: 20% Getting block 116 of 210 Reserving size (4425267) for bucket 116 Calculating Z arrays for bucket 116 Entering block accumulator loop for bucket 116: Sorting block time: 00:00:01 Returning block of 1476601 for bucket 96 Getting block 117 of 210 Reserving size (4425267) for bucket 117 Calculating Z arrays for bucket 117 Entering block accumulator loop for bucket 117: Getting block 118 of 210 Reserving size (4425267) for bucket 118 Calculating Z arrays for bucket 118 Entering block accumulator loop for bucket 118: bucket 114: 10% Sorting block time: 00:00:04 Returning block of 4030240 for bucket 63 bucket 111: 20% bucket 107: 80% Sorting block time: 00:00:04 Returning block of 3876033 for bucket 91 bucket 90: 10% bucket 69: 90% bucket 85: 30% Getting block 93 of 199 Reserving size (4425267) for bucket 93 Calculating Z arrays for bucket 93 Entering block accumulator loop for bucket 93: Sorting block time: 00:00:03 Returning block of 4192256 for bucket 68 bucket 76: 90% bucket 110: 50% Getting block 119 of 210 Reserving size (4425267) for bucket 119 Calculating Z arrays for bucket 119 Entering block accumulator loop for bucket 119: Sorting block time: 00:00:01 Returning block of 1536280 for bucket 102 Getting block 94 of 199 Reserving size (4425267) for bucket 94 Calculating Z arrays for bucket 94 Entering block accumulator loop for bucket 94: bucket 98: 100% Sorting block of length 3721286 for bucket 98 (Using difference cover) bucket 104: 100% Sorting block of length 1872796 for bucket 104 (Using difference cover) bucket 103: 100% Sorting block of length 3393053 for bucket 103 (Using difference cover) bucket 79: 90% Getting block 120 of 210 Reserving size (4425267) for bucket 120 Calculating Z arrays for bucket 120 Entering block accumulator loop for bucket 120: bucket 81: 100% Sorting block of length 3318951 for bucket 81 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2711364 for bucket 92 bucket 73: 90% bucket 88: 20% bucket 84: 30% Getting block 121 of 210 Reserving size (4425267) for bucket 121 Calculating Z arrays for bucket 121 Entering block accumulator loop for bucket 121: bucket 105: 90% bucket 116: 10% bucket 82: 50% bucket 112: 30% bucket 113: 20% bucket 115: 10% Sorting block time: 00:00:03 Returning block of 3117708 for bucket 99 bucket 75: 100% Sorting block of length 2313793 for bucket 75 (Using difference cover) bucket 72: 100% Sorting block of length 4062542 for bucket 72 (Using difference cover) Getting block 122 of 210 Reserving size (4425267) for bucket 122 Calculating Z arrays for bucket 122 Entering block accumulator loop for bucket 122: bucket 108: 80% bucket 109: 50% bucket 106: 80% bucket 92: 10% bucket 91: 10% bucket 86: 30% bucket 114: 20% bucket 117: 10% Sorting block time: 00:00:03 Returning block of 3345216 for bucket 94 bucket 89: 30% bucket 110: 60% bucket 107: 90% Getting block 123 of 210 Reserving size (4425267) for bucket 123 Calculating Z arrays for bucket 123 Entering block accumulator loop for bucket 123: bucket 83: 40% bucket 118: 10% bucket 119: 10% bucket 111: 30% Sorting block time: 00:00:03 Returning block of 2890372 for bucket 78 bucket 87: 30% Getting block 95 of 199 Reserving size (4425267) for bucket 95 Calculating Z arrays for bucket 95 Entering block accumulator loop for bucket 95: bucket 120: 10% Sorting block time: 00:00:02 Returning block of 1872797 for bucket 104 Sorting block time: 00:00:04 Returning block of 4000955 for bucket 89 Sorting block time: 00:00:04 Returning block of 4327293 for bucket 80 Getting block 124 of 210 Reserving size (4425267) for bucket 124 Calculating Z arrays for bucket 124 Entering block accumulator loop for bucket 124: Sorting block time: 00:00:04 Returning block of 3976394 for bucket 71 bucket 70: 100% Sorting block of length 3418218 for bucket 70 (Using difference cover) bucket 77: 100% Sorting block of length 2849746 for bucket 77 (Using difference cover) bucket 116: 20% Getting block 125 of 210 Reserving size (4425267) for bucket 125 Calculating Z arrays for bucket 125 Entering block accumulator loop for bucket 125: Getting block 96 of 199 Reserving size (4425267) for bucket 96 Calculating Z arrays for bucket 96 Entering block accumulator loop for bucket 96: Sorting block time: 00:00:03 Returning block of 3640303 for bucket 101 bucket 109: 60% Getting block 97 of 199 Reserving size (4425267) for bucket 97 Calculating Z arrays for bucket 97 Entering block accumulator loop for bucket 97: Sorting block time: 00:00:03 Returning block of 4316670 for bucket 93 bucket 115: 20% bucket 121: 10% Getting block 126 of 210 Reserving size (4425267) for bucket 126 Calculating Z arrays for bucket 126 Entering block accumulator loop for bucket 126: Sorting block time: 00:00:03 Returning block of 3860307 for bucket 100 bucket 76: 100% Sorting block of length 2598513 for bucket 76 (Using difference cover) bucket 112: 40% bucket 90: 20% bucket 113: 30% Getting block 127 of 210 Reserving size (4425267) for bucket 127 Calculating Z arrays for bucket 127 Entering block accumulator loop for bucket 127: Getting block 128 of 210 Reserving size (4425267) for bucket 128 Calculating Z arrays for bucket 128 Entering block accumulator loop for bucket 128: bucket 114: 30% bucket 85: 40% Sorting block time: 00:00:04 Returning block of 3750130 for bucket 67 bucket 105: 100% Sorting block of length 3586347 for bucket 105 (Using difference cover) bucket 122: 10% Getting block 98 of 199 Reserving size (4425267) for bucket 98 Calculating Z arrays for bucket 98 Entering block accumulator loop for bucket 98: bucket 79: 100% Sorting block of length 4403009 for bucket 79 (Using difference cover) bucket 69: 100% Sorting block of length 2916630 for bucket 69 (Using difference cover) bucket 108: 90% Sorting block time: 00:00:02 Returning block of 2313794 for bucket 75 bucket 82: 60% bucket 118: 20% Sorting block time: 00:00:04 Returning block of 3520539 for bucket 74 bucket 93: 10% Sorting block time: 00:00:03 Returning block of 3393054 for bucket 103 bucket 106: 90% Getting block 99 of 199 Reserving size (4425267) for bucket 99 Calculating Z arrays for bucket 99 Entering block accumulator loop for bucket 99: bucket 110: 70% bucket 117: 20% Getting block 100 of 199 Reserving size (4425267) for bucket 100 Calculating Z arrays for bucket 100 Entering block accumulator loop for bucket 100: bucket 88: 30% bucket 73: 100% Sorting block of length 3115509 for bucket 73 (Using difference cover) bucket 94: 10% bucket 107: 100% Sorting block of length 3613545 for bucket 107 (Using difference cover) Getting block 129 of 210 Reserving size (4425267) for bucket 129 Calculating Z arrays for bucket 129 Entering block accumulator loop for bucket 129: bucket 119: 20% bucket 83: 50% Sorting block time: 00:00:05 Returning block of 4385616 for bucket 95 bucket 92: 20% bucket 123: 10% Sorting block time: 00:00:03 Returning block of 3318952 for bucket 81 bucket 84: 40% bucket 86: 40% bucket 120: 20% bucket 91: 20% bucket 112: 50% Getting block 101 of 199 Reserving size (4425267) for bucket 101 Calculating Z arrays for bucket 101 Entering block accumulator loop for bucket 101: bucket 111: 40% Getting block 130 of 210 Reserving size (4425267) for bucket 130 Calculating Z arrays for bucket 130 Entering block accumulator loop for bucket 130: bucket 124: 10% bucket 114: 40% bucket 116: 30% Sorting block time: 00:00:04 Returning block of 3721287 for bucket 98 bucket 109: 70% bucket 115: 30% Getting block 131 of 210 Reserving size (4425267) for bucket 131 Calculating Z arrays for bucket 131 Entering block accumulator loop for bucket 131: bucket 125: 10% bucket 113: 40% bucket 121: 20% bucket 95: 10% bucket 96: 10% bucket 128: 10% bucket 122: 20% bucket 89: 40% bucket 87: 40% bucket 126: 10% bucket 127: 10% bucket 97: 10% bucket 120: 30% bucket 119: 30% Sorting block time: 00:00:03 Returning block of 4062543 for bucket 72 Sorting block time: 00:00:02 Returning block of 3418219 for bucket 70 bucket 108: 100% Sorting block of length 1887055 for bucket 108 (Using difference cover) Sorting block time: 00:00:03 Returning block of 2598514 for bucket 76 bucket 110: 80% Getting block 102 of 199 Reserving size (4425267) for bucket 102 Calculating Z arrays for bucket 102 Entering block accumulator loop for bucket 102: bucket 100: 10% Getting block 103 of 199 Reserving size (4425267) for bucket 103 Calculating Z arrays for bucket 103 Entering block accumulator loop for bucket 103: bucket 118: 30% bucket 115: 40% bucket 114: 50% Getting block 104 of 199 Reserving size (4425267) for bucket 104 Calculating Z arrays for bucket 104 Entering block accumulator loop for bucket 104: bucket 112: 60% Sorting block time: 00:00:03 Returning block of 2849747 for bucket 77 bucket 106: 100% Sorting block of length 3422499 for bucket 106 (Using difference cover) bucket 117: 30% bucket 82: 70% Getting block 105 of 199 Reserving size (4425267) for bucket 105 Calculating Z arrays for bucket 105 Entering block accumulator loop for bucket 105: bucket 123: 20% bucket 101: 10% bucket 124: 20% bucket 129: 10% bucket 90: 30% bucket 116: 40% bucket 98: 10% bucket 85: 50% bucket 109: 80% Sorting block time: 00:00:02 Returning block of 2916631 for bucket 69 bucket 86: 50% bucket 93: 20% bucket 99: 10% bucket 83: 60% bucket 119: 40% bucket 111: 50% Getting block 106 of 199 Reserving size (4425267) for bucket 106 Calculating Z arrays for bucket 106 Entering block accumulator loop for bucket 106: bucket 128: 20% bucket 130: 10% bucket 121: 30% bucket 88: 40% bucket 122: 30% bucket 92: 30% bucket 125: 20% bucket 84: 50% bucket 131: 10% bucket 113: 50% bucket 91: 30% Sorting block time: 00:00:04 Returning block of 3586348 for bucket 105 bucket 120: 40% bucket 95: 20% bucket 114: 60% bucket 112: 70% Sorting block time: 00:00:02 Returning block of 1887056 for bucket 108 Getting block 132 of 210 Reserving size (4425267) for bucket 132 Calculating Z arrays for bucket 132 Entering block accumulator loop for bucket 132: bucket 94: 20% bucket 126: 20% Sorting block time: 00:00:03 Returning block of 3115510 for bucket 73 bucket 115: 50% Getting block 133 of 210 Reserving size (4425267) for bucket 133 Calculating Z arrays for bucket 133 Entering block accumulator loop for bucket 133: bucket 110: 90% bucket 96: 20% bucket 127: 20% bucket 87: 50% bucket 116: 50% Sorting block time: 00:00:03 Returning block of 3613546 for bucket 107 Getting block 107 of 199 Reserving size (4425267) for bucket 107 Calculating Z arrays for bucket 107 Entering block accumulator loop for bucket 107: Sorting block time: 00:00:03 Returning block of 4403010 for bucket 79 bucket 118: 40% bucket 97: 20% bucket 123: 30% Getting block 134 of 210 Reserving size (4425267) for bucket 134 Calculating Z arrays for bucket 134 Entering block accumulator loop for bucket 134: Getting block 108 of 199 Reserving size (4425267) for bucket 108 Calculating Z arrays for bucket 108 Entering block accumulator loop for bucket 108: bucket 100: 20% bucket 124: 30% bucket 89: 50% bucket 117: 40% bucket 105: 10% bucket 109: 90% bucket 129: 20% bucket 119: 50% bucket 111: 60% bucket 115: 60% bucket 122: 40% bucket 128: 30% bucket 102: 10% bucket 101: 20% bucket 121: 40% bucket 83: 70% bucket 82: 80% bucket 86: 60% bucket 110: 100% Sorting block of length 3239758 for bucket 110 (Using difference cover) bucket 112: 80% bucket 126: 30% bucket 103: 10% bucket 125: 30% bucket 131: 20% bucket 120: 50% bucket 130: 20% bucket 113: 60% bucket 114: 70% bucket 104: 10% bucket 85: 60% bucket 90: 40% bucket 116: 60% bucket 98: 20% bucket 91: 40% bucket 132: 10% bucket 99: 20% Sorting block time: 00:00:03 Returning block of 3422500 for bucket 106 bucket 127: 30% bucket 92: 40% bucket 106: 10% bucket 124: 40% bucket 118: 50% Getting block 135 of 210 Reserving size (4425267) for bucket 135 Calculating Z arrays for bucket 135 Entering block accumulator loop for bucket 135: bucket 122: 50% bucket 95: 30% bucket 96: 30% bucket 112: 90% bucket 93: 30% bucket 133: 10% bucket 123: 40% bucket 100: 30% bucket 94: 30% bucket 84: 60% bucket 109: 100% Sorting block of length 4147848 for bucket 109 (Using difference cover) bucket 134: 10% bucket 119: 60% bucket 115: 70% bucket 126: 40% bucket 107: 10% bucket 129: 30% bucket 97: 30% bucket 101: 30% bucket 87: 60% bucket 128: 40% bucket 117: 50% bucket 105: 20% bucket 111: 70% bucket 88: 50% bucket 121: 50% bucket 114: 80% bucket 89: 60% bucket 116: 70% bucket 108: 10% bucket 120: 60% bucket 83: 80% bucket 124: 50% bucket 125: 40% bucket 113: 70% bucket 131: 30% bucket 130: 30% bucket 102: 20% bucket 86: 70% bucket 103: 20% bucket 115: 80% bucket 122: 60% bucket 82: 90% bucket 112: 100% Sorting block of length 4236819 for bucket 112 (Using difference cover) bucket 104: 20% bucket 127: 40% bucket 85: 70% bucket 118: 60% bucket 132: 20% bucket 128: 50% bucket 119: 70% bucket 123: 50% bucket 91: 50% Sorting block time: 00:00:03 Returning block of 3239759 for bucket 110 bucket 99: 30% bucket 98: 30% Getting block 136 of 210 Reserving size (4425267) for bucket 136 Calculating Z arrays for bucket 136 Entering block accumulator loop for bucket 136: bucket 95: 40% bucket 129: 40% bucket 126: 50% bucket 133: 20% bucket 101: 40% bucket 100: 40% bucket 92: 50% bucket 114: 90% bucket 135: 10% bucket 106: 20% bucket 121: 60% bucket 90: 50% bucket 117: 60% bucket 134: 20% bucket 120: 70% bucket 116: 80% bucket 96: 40% bucket 122: 70% bucket 124: 60% Sorting block time: 00:00:02 Returning block of 4147849 for bucket 109 bucket 111: 80% bucket 97: 40% bucket 125: 50% bucket 128: 60% Getting block 137 of 210 Reserving size (4425267) for bucket 137 Calculating Z arrays for bucket 137 Entering block accumulator loop for bucket 137: bucket 105: 30% bucket 94: 40% bucket 93: 40% bucket 115: 90% bucket 84: 70% bucket 86: 80% bucket 130: 40% bucket 131: 40% bucket 87: 70% bucket 113: 80% bucket 89: 70% bucket 107: 20% bucket 108: 20% bucket 102: 30% bucket 118: 70% bucket 127: 50% bucket 136: 10% bucket 83: 90% bucket 119: 80% bucket 114: 100% Sorting block of length 3891618 for bucket 114 (Using difference cover) bucket 132: 30% bucket 123: 60% bucket 103: 30% bucket 82: 100% Sorting block of length 2961528 for bucket 82 (Using difference cover) bucket 122: 80% bucket 120: 80% bucket 129: 50% bucket 126: 60% bucket 104: 30% bucket 121: 70% bucket 133: 30% bucket 101: 50% bucket 116: 90% bucket 98: 40% bucket 88: 60% bucket 124: 70% bucket 135: 20% bucket 100: 50% bucket 115: 100% Sorting block of length 4239340 for bucket 115 (Using difference cover) bucket 117: 70% Sorting block time: 00:00:03 Returning block of 4236820 for bucket 112 bucket 92: 60% bucket 105: 40% bucket 128: 70% bucket 125: 60% bucket 111: 90% bucket 134: 30% bucket 85: 80% Getting block 138 of 210 Reserving size (4425267) for bucket 138 Calculating Z arrays for bucket 138 Entering block accumulator loop for bucket 138: bucket 137: 10% bucket 91: 60% bucket 120: 90% bucket 95: 50% bucket 96: 50% bucket 119: 90% bucket 99: 40% bucket 130: 50% bucket 131: 50% bucket 106: 30% bucket 94: 50% bucket 113: 90% bucket 118: 80% bucket 136: 20% bucket 124: 80% bucket 127: 60% bucket 122: 90% bucket 123: 70% bucket 102: 40% bucket 97: 50% bucket 129: 60% bucket 108: 30% bucket 101: 60% bucket 89: 80% bucket 83: 100% Sorting block of length 3177100 for bucket 83 (Using difference cover) bucket 128: 80% bucket 86: 90% bucket 121: 80% bucket 132: 40% bucket 100: 60% bucket 87: 80% bucket 119: 100% Sorting block of length 1995325 for bucket 119 (Using difference cover) bucket 90: 60% bucket 116: 100% Sorting block of length 1206009 for bucket 116 (Using difference cover) bucket 126: 70% bucket 84: 80% bucket 103: 40% bucket 133: 40% bucket 93: 50% bucket 135: 30% bucket 107: 30% bucket 125: 70% bucket 120: 100% Sorting block of length 3630732 for bucket 120 (Using difference cover) bucket 138: 10% bucket 98: 50% bucket 137: 20% bucket 128: 90% bucket 117: 80% bucket 111: 100% Sorting block of length 2388592 for bucket 111 (Using difference cover) bucket 124: 90% Sorting block time: 00:00:03 Returning block of 2961529 for bucket 82 bucket 105: 50% bucket 134: 40% Sorting block time: 00:00:03 Returning block of 3891619 for bucket 114 bucket 92: 70% Getting block 109 of 199 Reserving size (4425267) for bucket 109 Calculating Z arrays for bucket 109 Entering block accumulator loop for bucket 109: bucket 104: 40% Sorting block time: 00:00:01 Returning block of 1206010 for bucket 116 bucket 130: 60% bucket 136: 30% bucket 122: 100% Sorting block of length 4192020 for bucket 122 (Using difference cover) bucket 131: 60% bucket 127: 70% Getting block 139 of 210 Reserving size (4425267) for bucket 139 Calculating Z arrays for bucket 139 Entering block accumulator loop for bucket 139: bucket 113: 100% Sorting block of length 2162687 for bucket 113 (Using difference cover) Getting block 140 of 210 Reserving size (4425267) for bucket 140 Calculating Z arrays for bucket 140 Entering block accumulator loop for bucket 140: bucket 91: 70% bucket 100: 70% bucket 95: 60% bucket 99: 50% bucket 123: 80% bucket 118: 90% bucket 85: 90% bucket 106: 40% bucket 121: 90% bucket 88: 70% Sorting block time: 00:00:03 Returning block of 4239341 for bucket 115 Sorting block time: 00:00:02 Returning block of 1995326 for bucket 119 bucket 129: 70% bucket 96: 60% Getting block 141 of 210 Reserving size (4425267) for bucket 141 Calculating Z arrays for bucket 141 Entering block accumulator loop for bucket 141: bucket 94: 60% Getting block 142 of 210 Reserving size (4425267) for bucket 142 Calculating Z arrays for bucket 142 Entering block accumulator loop for bucket 142: bucket 102: 50% bucket 89: 90% bucket 132: 50% bucket 101: 70% bucket 125: 80% bucket 126: 80% bucket 87: 90% bucket 137: 30% bucket 133: 50% bucket 135: 40% bucket 103: 50% bucket 86: 100% Sorting block of length 4332242 for bucket 86 (Using difference cover) bucket 107: 40% bucket 124: 100% Sorting block of length 2842664 for bucket 124 (Using difference cover) bucket 97: 60% bucket 138: 20% bucket 128: 100% Sorting block of length 3013904 for bucket 128 (Using difference cover) bucket 140: 10% bucket 117: 90% bucket 131: 70% bucket 139: 10% bucket 108: 40% bucket 136: 40% bucket 90: 70% bucket 130: 70% Sorting block time: 00:00:03 Returning block of 3630733 for bucket 120 bucket 134: 50% bucket 100: 80% bucket 98: 60% bucket 127: 80% Getting block 143 of 210 Reserving size (4425267) for bucket 143 Calculating Z arrays for bucket 143 Entering block accumulator loop for bucket 143: bucket 123: 90% Sorting block time: 00:00:02 Returning block of 2388593 for bucket 111 bucket 91: 80% bucket 84: 90% bucket 121: 100% Sorting block of length 3949422 for bucket 121 (Using difference cover) bucket 118: 100% Sorting block of length 3050113 for bucket 118 (Using difference cover) Getting block 144 of 210 Reserving size (4425267) for bucket 144 Calculating Z arrays for bucket 144 Entering block accumulator loop for bucket 144: bucket 129: 80% bucket 105: 60% bucket 141: 10% bucket 142: 10% bucket 93: 60% Sorting block time: 00:00:03 Returning block of 2162688 for bucket 113 bucket 102: 60% bucket 95: 70% Getting block 145 of 210 Reserving size (4425267) for bucket 145 Calculating Z arrays for bucket 145 Entering block accumulator loop for bucket 145: bucket 109: 10% bucket 137: 40% bucket 85: 100% Sorting block of length 1833139 for bucket 85 (Using difference cover) bucket 92: 80% bucket 125: 90% bucket 104: 50% bucket 106: 50% bucket 132: 60% bucket 135: 50% bucket 138: 30% bucket 94: 70% bucket 133: 60% bucket 140: 20% bucket 126: 90% bucket 96: 70% bucket 101: 80% bucket 99: 60% Sorting block time: 00:00:02 Returning block of 2842665 for bucket 124 bucket 87: 100% Sorting block of length 4173255 for bucket 87 (Using difference cover) bucket 107: 50% Getting block 146 of 210 Reserving size (4425267) for bucket 146 Calculating Z arrays for bucket 146 Entering block accumulator loop for bucket 146: bucket 97: 70% bucket 131: 80% bucket 139: 20% bucket 117: 100% Sorting block of length 3850905 for bucket 117 (Using difference cover) bucket 136: 50% Sorting block time: 00:00:05 Returning block of 3177101 for bucket 83 bucket 103: 60% bucket 127: 90% bucket 88: 80% Getting block 110 of 199 Reserving size (4425267) for bucket 110 Calculating Z arrays for bucket 110 Entering block accumulator loop for bucket 110: bucket 130: 80% bucket 143: 10% bucket 123: 100% Sorting block of length 3752484 for bucket 123 (Using difference cover) bucket 91: 90% bucket 134: 60% bucket 89: 100% Sorting block of length 4250414 for bucket 89 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3013905 for bucket 128 bucket 138: 40% bucket 100: 90% bucket 144: 10% Getting block 147 of 210 Reserving size (4425267) for bucket 147 Calculating Z arrays for bucket 147 Entering block accumulator loop for bucket 147: bucket 129: 90% bucket 142: 20% bucket 141: 20% bucket 145: 10% bucket 98: 70% bucket 137: 50% bucket 125: 100% Sorting block of length 1604345 for bucket 125 (Using difference cover) Sorting block time: 00:00:02 Returning block of 1833140 for bucket 85 bucket 140: 30% Getting block 111 of 199 Reserving size (4425267) for bucket 111 Calculating Z arrays for bucket 111 Entering block accumulator loop for bucket 111: bucket 108: 50% bucket 135: 60% bucket 109: 20% bucket 139: 30% bucket 105: 70% bucket 132: 70% bucket 101: 90% bucket 146: 10% bucket 102: 70% bucket 104: 60% bucket 92: 90% bucket 95: 80% bucket 84: 100% Sorting block of length 3965797 for bucket 84 (Using difference cover) bucket 126: 100% Sorting block of length 4307487 for bucket 126 (Using difference cover) bucket 90: 80% bucket 133: 70% bucket 93: 70% bucket 136: 60% bucket 143: 20% bucket 106: 60% bucket 96: 80% bucket 131: 90% Sorting block time: 00:00:05 Returning block of 4192021 for bucket 122 Sorting block time: 00:00:04 Returning block of 4332243 for bucket 86 bucket 107: 60% Sorting block time: 00:00:04 Returning block of 3050114 for bucket 118 bucket 100: 100% Sorting block of length 3517333 for bucket 100 (Using difference cover) Getting block 148 of 210 Reserving size (4425267) for bucket 148 Calculating Z arrays for bucket 148 Entering block accumulator loop for bucket 148: Getting block 112 of 199 Reserving size (4425267) for bucket 112 Calculating Z arrays for bucket 112 Entering block accumulator loop for bucket 112: bucket 127: 100% Sorting block of length 1553705 for bucket 127 (Using difference cover) bucket 110: 10% bucket 99: 70% bucket 94: 80% Getting block 149 of 210 Reserving size (4425267) for bucket 149 Calculating Z arrays for bucket 149 Entering block accumulator loop for bucket 149: bucket 138: 50% bucket 142: 30% bucket 130: 90% bucket 147: 10% bucket 129: 100% Sorting block of length 3454070 for bucket 129 (Using difference cover) bucket 141: 30% Sorting block time: 00:00:01 Returning block of 1604346 for bucket 125 bucket 134: 70% bucket 145: 20% bucket 91: 100% Sorting block of length 3042471 for bucket 91 (Using difference cover) Getting block 150 of 210 Reserving size (4425267) for bucket 150 Calculating Z arrays for bucket 150 Entering block accumulator loop for bucket 150: bucket 144: 20% bucket 140: 40% bucket 137: 60% bucket 109: 30% bucket 97: 80% bucket 139: 40% bucket 103: 70% bucket 135: 70% bucket 136: 70% bucket 146: 20% Sorting block time: 00:00:05 Returning block of 3949423 for bucket 121 Sorting block time: 00:00:03 Returning block of 4250415 for bucket 89 bucket 111: 10% bucket 108: 60% bucket 132: 80% Getting block 151 of 210 Reserving size (4425267) for bucket 151 Calculating Z arrays for bucket 151 Entering block accumulator loop for bucket 151: Getting block 113 of 199 Reserving size (4425267) for bucket 113 Calculating Z arrays for bucket 113 Entering block accumulator loop for bucket 113: bucket 110: 20% bucket 98: 80% bucket 143: 30% bucket 101: 100% Sorting block of length 3346179 for bucket 101 (Using difference cover) bucket 105: 80% bucket 88: 90% bucket 131: 100% Sorting block of length 2881908 for bucket 131 (Using difference cover) bucket 148: 10% Sorting block time: 00:00:04 Returning block of 4173256 for bucket 87 bucket 92: 100% Sorting block of length 3561184 for bucket 92 (Using difference cover) bucket 138: 60% bucket 147: 20% bucket 133: 80% bucket 104: 70% bucket 141: 40% Getting block 114 of 199 Reserving size (4425267) for bucket 114 Calculating Z arrays for bucket 114 Entering block accumulator loop for bucket 114: bucket 95: 90% Sorting block time: 00:00:01 Returning block of 1553706 for bucket 127 bucket 140: 50% bucket 94: 90% bucket 106: 70% Getting block 152 of 210 Reserving size (4425267) for bucket 152 Calculating Z arrays for bucket 152 Entering block accumulator loop for bucket 152: bucket 142: 40% Sorting block time: 00:00:04 Returning block of 3850906 for bucket 117 bucket 102: 80% Getting block 153 of 210 Reserving size (4425267) for bucket 153 Calculating Z arrays for bucket 153 Entering block accumulator loop for bucket 153: bucket 145: 30% bucket 107: 70% bucket 144: 30% bucket 137: 70% bucket 149: 10% bucket 96: 90% bucket 90: 90% bucket 136: 80% bucket 130: 100% Sorting block of length 3103005 for bucket 130 (Using difference cover) bucket 134: 80% bucket 93: 80% bucket 150: 10% bucket 139: 50% bucket 112: 10% bucket 97: 90% bucket 109: 40% Sorting block time: 00:00:04 Returning block of 3752485 for bucket 123 bucket 141: 50% bucket 99: 80% bucket 140: 60% bucket 146: 30% Getting block 154 of 210 Reserving size (4425267) for bucket 154 Calculating Z arrays for bucket 154 Entering block accumulator loop for bucket 154: bucket 135: 80% bucket 143: 40% Sorting block time: 00:00:03 Returning block of 3517334 for bucket 100 bucket 110: 30% bucket 103: 80% Getting block 115 of 199 Reserving size (4425267) for bucket 115 Calculating Z arrays for bucket 115 Entering block accumulator loop for bucket 115: bucket 151: 10% bucket 138: 70% bucket 148: 20% Sorting block time: 00:00:03 Returning block of 3042472 for bucket 91 bucket 147: 30% bucket 111: 20% bucket 132: 90% Getting block 116 of 199 Reserving size (4425267) for bucket 116 Calculating Z arrays for bucket 116 Entering block accumulator loop for bucket 116: bucket 137: 80% Sorting block time: 00:00:04 Returning block of 3965798 for bucket 84 bucket 142: 50% bucket 113: 10% bucket 108: 70% bucket 133: 90% Sorting block time: 00:00:04 Returning block of 4307488 for bucket 126 bucket 98: 90% Getting block 117 of 199 Reserving size (4425267) for bucket 117 Calculating Z arrays for bucket 117 Entering block accumulator loop for bucket 117: bucket 140: 70% bucket 136: 90% Getting block 155 of 210 Reserving size (4425267) for bucket 155 Calculating Z arrays for bucket 155 Entering block accumulator loop for bucket 155: bucket 153: 10% bucket 114: 10% bucket 139: 60% Sorting block time: 00:00:03 Returning block of 3454071 for bucket 129 bucket 144: 40% bucket 105: 90% bucket 152: 10% bucket 146: 40% bucket 145: 40% bucket 104: 80% Getting block 156 of 210 Reserving size (4425267) for bucket 156 Calculating Z arrays for bucket 156 Entering block accumulator loop for bucket 156: bucket 106: 80% bucket 141: 60% bucket 149: 20% bucket 94: 100% Sorting block of length 4216900 for bucket 94 (Using difference cover) bucket 150: 20% Sorting block time: 00:00:03 Returning block of 2881909 for bucket 131 Sorting block time: 00:00:03 Returning block of 3346180 for bucket 101 bucket 134: 90% bucket 112: 20% bucket 95: 100% Sorting block of length 2575867 for bucket 95 (Using difference cover) Getting block 157 of 210 Reserving size (4425267) for bucket 157 Calculating Z arrays for bucket 157 Entering block accumulator loop for bucket 157: bucket 110: 40% Getting block 118 of 199 Reserving size (4425267) for bucket 118 Calculating Z arrays for bucket 118 Entering block accumulator loop for bucket 118: bucket 88: 100% Sorting block of length 4362972 for bucket 88 (Using difference cover) bucket 143: 50% bucket 109: 50% bucket 107: 80% bucket 116: 10% bucket 154: 10% bucket 102: 90% bucket 97: 100% Sorting block of length 4323211 for bucket 97 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3561185 for bucket 92 bucket 148: 30% bucket 96: 100% Sorting block of length 3494080 for bucket 96 (Using difference cover) bucket 135: 90% Getting block 119 of 199 Reserving size (4425267) for bucket 119 Calculating Z arrays for bucket 119 Entering block accumulator loop for bucket 119: bucket 138: 80% bucket 99: 90% bucket 147: 40% bucket 141: 70% bucket 132: 100% Sorting block of length 3667705 for bucket 132 (Using difference cover) bucket 151: 20% bucket 142: 60% bucket 103: 90% bucket 115: 10% bucket 137: 90% bucket 93: 90% bucket 111: 30% bucket 113: 20% bucket 136: 100% Sorting block of length 3284572 for bucket 136 (Using difference cover) bucket 90: 100% Sorting block of length 3855273 for bucket 90 (Using difference cover) bucket 139: 70% bucket 146: 50% bucket 140: 80% bucket 133: 100% Sorting block of length 1785979 for bucket 133 (Using difference cover) bucket 108: 80% bucket 153: 20% bucket 155: 10% bucket 152: 20% bucket 144: 50% bucket 149: 30% Sorting block time: 00:00:04 Returning block of 3103006 for bucket 130 bucket 143: 60% bucket 114: 20% bucket 117: 10% bucket 145: 50% bucket 150: 30% Getting block 158 of 210 Reserving size (4425267) for bucket 158 Calculating Z arrays for bucket 158 Entering block accumulator loop for bucket 158: bucket 110: 50% bucket 134: 100% Sorting block of length 3166094 for bucket 134 (Using difference cover) bucket 148: 40% bucket 146: 60% bucket 156: 10% bucket 157: 10% bucket 135: 100% Sorting block of length 2496699 for bucket 135 (Using difference cover) bucket 112: 30% bucket 118: 10% Sorting block time: 00:00:02 Returning block of 2575868 for bucket 95 bucket 105: 100% Sorting block of length 3883893 for bucket 105 (Using difference cover) bucket 154: 20% Getting block 120 of 199 Reserving size (4425267) for bucket 120 Calculating Z arrays for bucket 120 Entering block accumulator loop for bucket 120: bucket 138: 90% bucket 109: 60% bucket 98: 100% Sorting block of length 4081968 for bucket 98 (Using difference cover) bucket 119: 10% bucket 104: 90% bucket 106: 90% bucket 147: 50% bucket 116: 20% bucket 142: 70% bucket 141: 80% bucket 139: 80% bucket 137: 100% Sorting block of length 2496412 for bucket 137 (Using difference cover) bucket 151: 30% bucket 113: 30% bucket 114: 30% bucket 107: 90% bucket 115: 20% bucket 140: 90% bucket 111: 40% bucket 153: 30% bucket 143: 70% Sorting block time: 00:00:03 Returning block of 3494081 for bucket 96 bucket 149: 40% bucket 102: 100% Sorting block of length 2190193 for bucket 102 (Using difference cover) bucket 99: 100% Sorting block of length 2700014 for bucket 99 (Using difference cover) bucket 144: 60% Getting block 121 of 199 Reserving size (4425267) for bucket 121 Calculating Z arrays for bucket 121 Entering block accumulator loop for bucket 121: bucket 103: 100% Sorting block of length 3390260 for bucket 103 (Using difference cover) Sorting block time: 00:00:02 Returning block of 1785980 for bucket 133 Sorting block time: 00:00:03 Returning block of 4216901 for bucket 94 Getting block 159 of 210 Reserving size (4425267) for bucket 159 Calculating Z arrays for bucket 159 Entering block accumulator loop for bucket 159: bucket 138: 100% Sorting block of length 3946972 for bucket 138 (Using difference cover) bucket 152: 30% Getting block 122 of 199 Reserving size (4425267) for bucket 122 Calculating Z arrays for bucket 122 Entering block accumulator loop for bucket 122: bucket 139: 90% bucket 148: 50% bucket 145: 60% bucket 146: 70% bucket 150: 40% bucket 155: 20% bucket 110: 60% bucket 116: 30% bucket 119: 20% bucket 93: 100% Sorting block of length 4298953 for bucket 93 (Using difference cover) bucket 158: 10% bucket 142: 80% bucket 154: 30% bucket 157: 20% Sorting block time: 00:00:04 Returning block of 4323212 for bucket 97 bucket 108: 90% bucket 147: 60% Sorting block time: 00:00:04 Returning block of 4362973 for bucket 88 Getting block 123 of 199 Reserving size (4425267) for bucket 123 Calculating Z arrays for bucket 123 Entering block accumulator loop for bucket 123: bucket 141: 90% bucket 156: 20% bucket 118: 20% Sorting block time: 00:00:03 Returning block of 3284573 for bucket 136 Getting block 124 of 199 Reserving size (4425267) for bucket 124 Calculating Z arrays for bucket 124 Entering block accumulator loop for bucket 124: bucket 117: 20% Getting block 160 of 210 Reserving size (4425267) for bucket 160 Calculating Z arrays for bucket 160 Entering block accumulator loop for bucket 160: bucket 109: 70% bucket 140: 100% Sorting block of length 2437206 for bucket 140 (Using difference cover) Sorting block time: 00:00:04 Returning block of 3667706 for bucket 132 bucket 151: 40% Sorting block time: 00:00:03 Returning block of 2496700 for bucket 135 bucket 112: 40% bucket 121: 10% bucket 114: 40% Getting block 161 of 210 Reserving size (4425267) for bucket 161 Calculating Z arrays for bucket 161 Entering block accumulator loop for bucket 161: Sorting block time: 00:00:04 Returning block of 3855274 for bucket 90 bucket 120: 10% bucket 143: 80% Getting block 162 of 210 Reserving size (4425267) for bucket 162 Calculating Z arrays for bucket 162 Entering block accumulator loop for bucket 162: bucket 153: 40% bucket 111: 50% bucket 106: 100% Sorting block of length 3071212 for bucket 106 (Using difference cover) Getting block 125 of 199 Reserving size (4425267) for bucket 125 Calculating Z arrays for bucket 125 Entering block accumulator loop for bucket 125: bucket 115: 30% bucket 149: 50% bucket 104: 100% Sorting block of length 3591082 for bucket 104 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3883894 for bucket 105 bucket 144: 70% bucket 110: 70% Sorting block time: 00:00:02 Returning block of 2700015 for bucket 99 bucket 148: 60% bucket 139: 100% Sorting block of length 3961758 for bucket 139 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2496413 for bucket 137 bucket 113: 40% Sorting block time: 00:00:03 Returning block of 3166095 for bucket 134 bucket 146: 80% Getting block 126 of 199 Reserving size (4425267) for bucket 126 Calculating Z arrays for bucket 126 Entering block accumulator loop for bucket 126: Getting block 127 of 199 Reserving size (4425267) for bucket 127 Calculating Z arrays for bucket 127 Entering block accumulator loop for bucket 127: Getting block 163 of 210 Reserving size (4425267) for bucket 163 Calculating Z arrays for bucket 163 Entering block accumulator loop for bucket 163: bucket 159: 10% Sorting block time: 00:00:02 Returning block of 2190194 for bucket 102 bucket 150: 50% bucket 145: 70% bucket 152: 40% Getting block 164 of 210 Reserving size (4425267) for bucket 164 Calculating Z arrays for bucket 164 Entering block accumulator loop for bucket 164: bucket 142: 90% bucket 107: 100% Sorting block of length 1963246 for bucket 107 (Using difference cover) Getting block 128 of 199 Reserving size (4425267) for bucket 128 Calculating Z arrays for bucket 128 Entering block accumulator loop for bucket 128: bucket 157: 30% bucket 122: 10% bucket 141: 100% Sorting block of length 4325249 for bucket 141 (Using difference cover) bucket 147: 70% bucket 158: 20% bucket 154: 40% bucket 155: 30% bucket 116: 40% Sorting block time: 00:00:04 Returning block of 4081969 for bucket 98 bucket 118: 30% bucket 123: 10% bucket 160: 10% bucket 109: 80% bucket 156: 30% bucket 119: 30% bucket 112: 50% Sorting block time: 00:00:02 Returning block of 2437207 for bucket 140 Getting block 129 of 199 Reserving size (4425267) for bucket 129 Calculating Z arrays for bucket 129 Entering block accumulator loop for bucket 129: Sorting block time: 00:00:03 Returning block of 3390261 for bucket 103 Getting block 165 of 210 Reserving size (4425267) for bucket 165 Calculating Z arrays for bucket 165 Entering block accumulator loop for bucket 165: Getting block 130 of 199 Reserving size (4425267) for bucket 130 Calculating Z arrays for bucket 130 Entering block accumulator loop for bucket 130: bucket 143: 90% bucket 151: 50% bucket 108: 100% Sorting block of length 2590380 for bucket 108 (Using difference cover) bucket 121: 20% bucket 161: 10% bucket 111: 60% bucket 153: 50% bucket 162: 10% bucket 149: 60% bucket 113: 50% bucket 120: 20% bucket 148: 70% bucket 124: 10% bucket 117: 30% Sorting block time: 00:00:04 Returning block of 3946973 for bucket 138 bucket 163: 10% bucket 114: 50% bucket 146: 90% bucket 126: 10% Sorting block time: 00:00:02 Returning block of 1963247 for bucket 107 bucket 115: 40% bucket 142: 100% Sorting block of length 1584808 for bucket 142 (Using difference cover) bucket 157: 40% Getting block 131 of 199 Reserving size (4425267) for bucket 131 Calculating Z arrays for bucket 131 Entering block accumulator loop for bucket 131: Getting block 166 of 210 Reserving size (4425267) for bucket 166 Calculating Z arrays for bucket 166 Entering block accumulator loop for bucket 166: bucket 144: 80% bucket 150: 60% bucket 147: 80% bucket 118: 40% Sorting block time: 00:00:03 Returning block of 4298954 for bucket 93 bucket 125: 10% bucket 159: 20% bucket 152: 50% bucket 145: 80% bucket 127: 10% bucket 164: 10% Sorting block time: 00:00:03 Returning block of 3071213 for bucket 106 bucket 154: 50% Getting block 132 of 199 Reserving size (4425267) for bucket 132 Calculating Z arrays for bucket 132 Entering block accumulator loop for bucket 132: bucket 165: 10% Getting block 133 of 199 Reserving size (4425267) for bucket 133 Calculating Z arrays for bucket 133 Entering block accumulator loop for bucket 133: bucket 158: 30% bucket 122: 20% bucket 160: 20% bucket 110: 80% bucket 155: 40% bucket 111: 70% Sorting block time: 00:00:03 Returning block of 3961759 for bucket 139 bucket 121: 30% bucket 123: 20% bucket 109: 90% bucket 116: 50% bucket 128: 10% Sorting block time: 00:00:03 Returning block of 3591083 for bucket 104 bucket 143: 100% Sorting block of length 4335564 for bucket 143 (Using difference cover) bucket 156: 40% Sorting block time: 00:00:01 Returning block of 1584809 for bucket 142 Getting block 167 of 210 Reserving size (4425267) for bucket 167 Calculating Z arrays for bucket 167 Entering block accumulator loop for bucket 167: Getting block 134 of 199 Reserving size (4425267) for bucket 134 Calculating Z arrays for bucket 134 Entering block accumulator loop for bucket 134: Getting block 168 of 210 Reserving size (4425267) for bucket 168 Calculating Z arrays for bucket 168 Entering block accumulator loop for bucket 168: bucket 149: 70% bucket 151: 60% bucket 161: 20% bucket 146: 100% Sorting block of length 2475930 for bucket 146 (Using difference cover) bucket 162: 20% bucket 119: 40% bucket 148: 80% Sorting block time: 00:00:03 Returning block of 2590381 for bucket 108 bucket 166: 10% bucket 112: 60% bucket 163: 20% bucket 157: 50% Getting block 135 of 199 Reserving size (4425267) for bucket 135 Calculating Z arrays for bucket 135 Entering block accumulator loop for bucket 135: bucket 153: 60% bucket 113: 60% bucket 160: 30% bucket 118: 50% bucket 147: 90% bucket 129: 10% bucket 150: 70% bucket 120: 30% bucket 115: 50% bucket 114: 60% bucket 126: 20% bucket 159: 30% bucket 144: 90% bucket 152: 60% bucket 165: 20% bucket 130: 10% Sorting block time: 00:00:03 Returning block of 4325250 for bucket 141 bucket 109: 100% Sorting block of length 3442356 for bucket 109 (Using difference cover) bucket 125: 20% bucket 124: 20% bucket 145: 90% Getting block 169 of 210 Reserving size (4425267) for bucket 169 Calculating Z arrays for bucket 169 Entering block accumulator loop for bucket 169: bucket 164: 20% bucket 117: 40% bucket 154: 60% bucket 158: 40% bucket 116: 60% bucket 155: 50% bucket 121: 40% bucket 167: 10% bucket 111: 80% bucket 131: 10% bucket 122: 30% bucket 123: 30% bucket 162: 30% bucket 160: 40% bucket 168: 10% Sorting block time: 00:00:02 Returning block of 2475931 for bucket 146 bucket 149: 80% bucket 148: 90% Getting block 170 of 210 Reserving size (4425267) for bucket 170 Calculating Z arrays for bucket 170 Entering block accumulator loop for bucket 170: bucket 150: 80% bucket 156: 50% bucket 151: 70% bucket 161: 30% bucket 157: 60% bucket 163: 30% bucket 132: 10% bucket 147: 100% Sorting block of length 3321966 for bucket 147 (Using difference cover) bucket 110: 90% bucket 128: 20% bucket 166: 20% bucket 153: 70% bucket 127: 20% bucket 119: 50% bucket 112: 70% bucket 133: 10% bucket 169: 10% bucket 134: 10% bucket 118: 60% bucket 165: 30% Sorting block time: 00:00:03 Returning block of 4335565 for bucket 143 bucket 159: 40% bucket 144: 100% Sorting block of length 2534651 for bucket 144 (Using difference cover) bucket 152: 70% bucket 113: 70% Getting block 171 of 210 Reserving size (4425267) for bucket 171 Calculating Z arrays for bucket 171 Entering block accumulator loop for bucket 171: bucket 115: 60% bucket 129: 20% bucket 124: 30% bucket 135: 10% bucket 126: 30% bucket 160: 50% bucket 125: 30% bucket 164: 30% bucket 114: 70% bucket 145: 100% Sorting block of length 2206093 for bucket 145 (Using difference cover) bucket 150: 90% bucket 120: 40% bucket 168: 20% bucket 148: 100% Sorting block of length 1797554 for bucket 148 (Using difference cover) bucket 158: 50% bucket 167: 20% bucket 162: 40% bucket 121: 50% Sorting block time: 00:00:03 Returning block of 3442357 for bucket 109 bucket 170: 10% bucket 155: 60% Getting block 136 of 199 Reserving size (4425267) for bucket 136 Calculating Z arrays for bucket 136 Entering block accumulator loop for bucket 136: bucket 163: 40% bucket 131: 20% bucket 110: 100% Sorting block of length 2004859 for bucket 110 (Using difference cover) bucket 151: 80% bucket 111: 90% bucket 149: 90% bucket 157: 70% bucket 154: 70% bucket 130: 20% bucket 117: 50% bucket 153: 80% bucket 122: 40% bucket 123: 40% bucket 161: 40% bucket 156: 60% bucket 171: 10% bucket 165: 40% bucket 169: 20% bucket 166: 30% bucket 160: 60% Sorting block time: 00:00:03 Returning block of 3321967 for bucket 147 bucket 168: 30% bucket 115: 70% bucket 116: 70% Getting block 172 of 210 Reserving size (4425267) for bucket 172 Calculating Z arrays for bucket 172 Entering block accumulator loop for bucket 172: bucket 112: 80% bucket 118: 70% bucket 152: 80% bucket 159: 50% bucket 127: 30% Sorting block time: 00:00:02 Returning block of 2534652 for bucket 144 bucket 126: 40% Sorting block time: 00:00:01 Returning block of 1797555 for bucket 148 Getting block 173 of 210 Reserving size (4425267) for bucket 173 Calculating Z arrays for bucket 173 Entering block accumulator loop for bucket 173: Getting block 174 of 210 Reserving size (4425267) for bucket 174 Calculating Z arrays for bucket 174 Entering block accumulator loop for bucket 174: bucket 150: 100% Sorting block of length 2764453 for bucket 150 (Using difference cover) bucket 128: 30% bucket 134: 20% bucket 167: 30% bucket 162: 50% bucket 132: 20% bucket 113: 80% bucket 121: 60% bucket 163: 50% bucket 114: 80% bucket 164: 40% bucket 158: 60% bucket 170: 20% bucket 133: 20% bucket 119: 60% bucket 169: 30% bucket 124: 40% bucket 165: 50% bucket 125: 40% Sorting block time: 00:00:02 Returning block of 2004860 for bucket 110 bucket 168: 40% bucket 136: 10% Getting block 137 of 199 Reserving size (4425267) for bucket 137 Calculating Z arrays for bucket 137 Entering block accumulator loop for bucket 137: bucket 151: 90% bucket 157: 80% bucket 155: 70% bucket 149: 100% Sorting block of length 3050143 for bucket 149 (Using difference cover) Sorting block time: 00:00:03 Returning block of 2206094 for bucket 145 bucket 129: 30% Getting block 175 of 210 Reserving size (4425267) for bucket 175 Calculating Z arrays for bucket 175 Entering block accumulator loop for bucket 175: bucket 172: 10% bucket 154: 80% bucket 111: 100% Sorting block of length 2654438 for bucket 111 (Using difference cover) bucket 171: 20% bucket 122: 50% bucket 160: 70% bucket 153: 90% bucket 131: 30% bucket 115: 80% bucket 161: 50% bucket 120: 50% bucket 117: 60% bucket 135: 20% bucket 174: 10% bucket 166: 40% bucket 156: 70% bucket 123: 50% bucket 152: 90% bucket 130: 30% bucket 163: 60% bucket 112: 90% bucket 159: 60% bucket 116: 80% bucket 165: 60% bucket 113: 90% bucket 167: 40% bucket 162: 60% bucket 126: 50% bucket 118: 80% bucket 173: 10% bucket 168: 50% bucket 137: 10% bucket 158: 70% bucket 170: 30% bucket 164: 50% bucket 119: 70% bucket 169: 40% bucket 172: 20% bucket 134: 30% bucket 127: 40% bucket 157: 90% bucket 121: 70% bucket 174: 20% bucket 114: 90% bucket 132: 30% bucket 155: 80% bucket 151: 100% Sorting block of length 1811462 for bucket 151 (Using difference cover) bucket 171: 30% bucket 124: 50% bucket 123: 60% bucket 160: 80% bucket 154: 90% bucket 128: 40% bucket 125: 50% bucket 133: 30% bucket 122: 60% bucket 175: 10% bucket 115: 90% bucket 163: 70% bucket 161: 60% bucket 165: 70% bucket 153: 100% Sorting block of length 3768265 for bucket 153 (Using difference cover) bucket 166: 50% bucket 117: 70% Sorting block time: 00:00:02 Returning block of 2654439 for bucket 111 bucket 136: 20% bucket 113: 100% Sorting block of length 3461774 for bucket 113 (Using difference cover) Getting block 138 of 199 Reserving size (4425267) for bucket 138 Calculating Z arrays for bucket 138 Entering block accumulator loop for bucket 138: bucket 168: 60% Sorting block time: 00:00:03 Returning block of 3050144 for bucket 149 bucket 131: 40% bucket 156: 80% bucket 152: 100% Sorting block of length 2687581 for bucket 152 (Using difference cover) bucket 129: 40% bucket 135: 30% bucket 159: 70% bucket 167: 50% Getting block 176 of 210 Reserving size (4425267) for bucket 176 Calculating Z arrays for bucket 176 Entering block accumulator loop for bucket 176: bucket 120: 60% bucket 162: 70% Sorting block time: 00:00:04 Returning block of 2764454 for bucket 150 Getting block 177 of 210 Reserving size (4425267) for bucket 177 Calculating Z arrays for bucket 177 Entering block accumulator loop for bucket 177: bucket 118: 90% bucket 170: 40% bucket 173: 20% bucket 116: 90% bucket 169: 50% bucket 172: 30% bucket 112: 100% Sorting block of length 2350639 for bucket 112 (Using difference cover) bucket 158: 80% bucket 157: 100% Sorting block of length 1374020 for bucket 157 (Using difference cover) bucket 171: 40% bucket 126: 60% bucket 160: 90% bucket 121: 80% bucket 164: 60% bucket 174: 30% bucket 165: 80% Sorting block time: 00:00:02 Returning block of 1811463 for bucket 151 bucket 119: 80% Getting block 178 of 210 Reserving size (4425267) for bucket 178 Calculating Z arrays for bucket 178 Entering block accumulator loop for bucket 178: bucket 130: 40% bucket 154: 100% Sorting block of length 4196989 for bucket 154 (Using difference cover) bucket 134: 40% bucket 155: 90% bucket 114: 100% Sorting block of length 2182107 for bucket 114 (Using difference cover) bucket 163: 80% bucket 137: 20% bucket 166: 60% bucket 123: 70% bucket 161: 70% bucket 175: 20% bucket 115: 100% Sorting block of length 4086233 for bucket 115 (Using difference cover) bucket 122: 70% bucket 170: 50% bucket 168: 70% bucket 128: 50% bucket 167: 60% bucket 132: 40% bucket 127: 50% bucket 172: 40% bucket 117: 80% Sorting block time: 00:00:01 Returning block of 1374021 for bucket 157 bucket 124: 60% Sorting block time: 00:00:01 Returning block of 2350640 for bucket 112 Getting block 179 of 210 Reserving size (4425267) for bucket 179 Calculating Z arrays for bucket 179 Entering block accumulator loop for bucket 179: bucket 162: 80% Sorting block time: 00:00:03 Returning block of 3461775 for bucket 113 bucket 136: 30% bucket 159: 80% bucket 177: 10% Getting block 139 of 199 Reserving size (4425267) for bucket 139 Calculating Z arrays for bucket 139 Entering block accumulator loop for bucket 139: bucket 174: 40% Getting block 140 of 199 Reserving size (4425267) for bucket 140 Calculating Z arrays for bucket 140 Entering block accumulator loop for bucket 140: bucket 176: 10% bucket 116: 100% Sorting block of length 2835836 for bucket 116 (Using difference cover) bucket 156: 90% bucket 118: 100% Sorting block of length 2150915 for bucket 118 (Using difference cover) bucket 169: 60% bucket 138: 10% bucket 163: 90% bucket 173: 30% bucket 126: 70% bucket 131: 50% bucket 121: 90% Sorting block time: 00:00:02 Returning block of 2687582 for bucket 152 bucket 171: 50% bucket 160: 100% Sorting block of length 3494151 for bucket 160 (Using difference cover) bucket 133: 40% bucket 125: 60% Getting block 180 of 210 Reserving size (4425267) for bucket 180 Calculating Z arrays for bucket 180 Entering block accumulator loop for bucket 180: bucket 135: 40% bucket 165: 90% bucket 158: 90% bucket 164: 70% bucket 120: 70% Sorting block time: 00:00:01 Returning block of 2182108 for bucket 114 bucket 178: 10% Getting block 141 of 199 Reserving size (4425267) for bucket 141 Calculating Z arrays for bucket 141 Entering block accumulator loop for bucket 141: bucket 129: 50% bucket 130: 50% bucket 119: 90% bucket 155: 100% Sorting block of length 3761355 for bucket 155 (Using difference cover) bucket 170: 60% bucket 166: 70% bucket 161: 80% bucket 168: 80% bucket 123: 80% bucket 175: 30% bucket 163: 100% Sorting block of length 3597211 for bucket 163 (Using difference cover) bucket 167: 70% bucket 172: 50% Sorting block time: 00:00:04 Returning block of 3768266 for bucket 153 Getting block 181 of 210 Reserving size (4425267) for bucket 181 Calculating Z arrays for bucket 181 Entering block accumulator loop for bucket 181: bucket 159: 90% bucket 177: 20% bucket 179: 10% bucket 124: 70% bucket 174: 50% bucket 137: 30% bucket 134: 50% bucket 176: 20% bucket 169: 70% bucket 117: 90% Sorting block time: 00:00:01 Returning block of 2150916 for bucket 118 bucket 162: 90% Getting block 142 of 199 Reserving size (4425267) for bucket 142 Calculating Z arrays for bucket 142 Entering block accumulator loop for bucket 142: bucket 128: 60% bucket 156: 100% Sorting block of length 3470249 for bucket 156 (Using difference cover) bucket 122: 80% bucket 171: 60% bucket 173: 40% bucket 178: 20% bucket 127: 60% bucket 165: 100% Sorting block of length 3766871 for bucket 165 (Using difference cover) bucket 132: 50% bucket 180: 10% bucket 136: 40% bucket 164: 80% bucket 158: 100% Sorting block of length 3803419 for bucket 158 (Using difference cover) bucket 133: 50% Sorting block time: 00:00:02 Returning block of 2835837 for bucket 116 Sorting block time: 00:00:03 Returning block of 4086234 for bucket 115 bucket 131: 60% Getting block 143 of 199 Reserving size (4425267) for bucket 143 Calculating Z arrays for bucket 143 Entering block accumulator loop for bucket 143: Sorting block time: 00:00:03 Returning block of 4196990 for bucket 154 bucket 126: 80% Getting block 144 of 199 Reserving size (4425267) for bucket 144 Calculating Z arrays for bucket 144 Entering block accumulator loop for bucket 144: bucket 177: 30% Getting block 182 of 210 Reserving size (4425267) for bucket 182 Calculating Z arrays for bucket 182 Entering block accumulator loop for bucket 182: bucket 168: 90% bucket 170: 70% bucket 135: 50% bucket 166: 80% bucket 120: 80% bucket 121: 100% Sorting block of length 1811564 for bucket 121 (Using difference cover) bucket 138: 20% bucket 125: 70% bucket 140: 10% bucket 139: 10% bucket 167: 80% bucket 161: 90% bucket 172: 60% bucket 119: 100% Sorting block of length 4338860 for bucket 119 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3494152 for bucket 160 bucket 129: 60% bucket 175: 40% bucket 169: 80% Getting block 183 of 210 Reserving size (4425267) for bucket 183 Calculating Z arrays for bucket 183 Entering block accumulator loop for bucket 183: bucket 181: 10% bucket 174: 60% bucket 159: 100% Sorting block of length 3378940 for bucket 159 (Using difference cover) bucket 141: 10% bucket 179: 20% bucket 176: 30% bucket 130: 60% bucket 162: 100% Sorting block of length 2322066 for bucket 162 (Using difference cover) bucket 171: 70% bucket 123: 90% bucket 178: 30% bucket 124: 80% bucket 122: 90% bucket 173: 50% bucket 180: 20% bucket 117: 100% Sorting block of length 3070245 for bucket 117 (Using difference cover) bucket 164: 90% bucket 143: 10% bucket 134: 60% bucket 128: 70% bucket 177: 40% Sorting block time: 00:00:01 Returning block of 1811565 for bucket 121 bucket 132: 60% bucket 168: 100% Sorting block of length 4000232 for bucket 168 (Using difference cover) bucket 182: 10% Getting block 145 of 199 Reserving size (4425267) for bucket 145 Calculating Z arrays for bucket 145 Entering block accumulator loop for bucket 145: bucket 170: 80% bucket 137: 40% bucket 166: 90% bucket 127: 70% Sorting block time: 00:00:03 Returning block of 3761356 for bucket 155 bucket 167: 90% Sorting block time: 00:00:03 Returning block of 3597212 for bucket 163 bucket 133: 60% bucket 169: 90% bucket 136: 50% Getting block 184 of 210 Reserving size (4425267) for bucket 184 Calculating Z arrays for bucket 184 Entering block accumulator loop for bucket 184: bucket 172: 70% bucket 161: 100% Sorting block of length 3946034 for bucket 161 (Using difference cover) bucket 181: 20% bucket 131: 70% bucket 142: 10% bucket 175: 50% bucket 135: 60% Getting block 185 of 210 Reserving size (4425267) for bucket 185 Calculating Z arrays for bucket 185 Entering block accumulator loop for bucket 185: bucket 126: 90% bucket 174: 70% bucket 120: 90% bucket 183: 10% bucket 179: 30% bucket 144: 10% bucket 176: 40% bucket 138: 30% bucket 171: 80% bucket 140: 20% Sorting block time: 00:00:03 Returning block of 3470250 for bucket 156 bucket 178: 40% bucket 180: 30% bucket 125: 80% Getting block 186 of 210 Reserving size (4425267) for bucket 186 Calculating Z arrays for bucket 186 Entering block accumulator loop for bucket 186: bucket 173: 60% bucket 129: 70% Sorting block time: 00:00:03 Returning block of 3803420 for bucket 158 bucket 139: 20% Sorting block time: 00:00:04 Returning block of 3766872 for bucket 165 Getting block 187 of 210 Reserving size (4425267) for bucket 187 Calculating Z arrays for bucket 187 Entering block accumulator loop for bucket 187: bucket 177: 50% bucket 124: 90% bucket 130: 70% Sorting block time: 00:00:03 Returning block of 2322067 for bucket 162 bucket 166: 100% Sorting block of length 3323913 for bucket 166 (Using difference cover) Getting block 188 of 210 Reserving size (4425267) for bucket 188 Calculating Z arrays for bucket 188 Entering block accumulator loop for bucket 188: bucket 164: 100% Sorting block of length 2428602 for bucket 164 (Using difference cover) bucket 135: 70% Getting block 189 of 210 Reserving size (4425267) for bucket 189 Calculating Z arrays for bucket 189 Entering block accumulator loop for bucket 189: bucket 170: 90% bucket 143: 20% Sorting block time: 00:00:02 Returning block of 3070246 for bucket 117 bucket 122: 100% Sorting block of length 3852936 for bucket 122 (Using difference cover) bucket 141: 20% bucket 169: 100% Sorting block of length 4182136 for bucket 169 (Using difference cover) bucket 123: 100% Sorting block of length 1842544 for bucket 123 (Using difference cover) bucket 167: 100% Sorting block of length 2883280 for bucket 167 (Using difference cover) Getting block 146 of 199 Reserving size (4425267) for bucket 146 Calculating Z arrays for bucket 146 Entering block accumulator loop for bucket 146: bucket 182: 20% Sorting block time: 00:00:03 Returning block of 4338861 for bucket 119 bucket 172: 80% bucket 184: 10% bucket 183: 20% bucket 132: 70% bucket 128: 80% bucket 181: 30% Getting block 147 of 199 Reserving size (4425267) for bucket 147 Calculating Z arrays for bucket 147 Entering block accumulator loop for bucket 147: bucket 174: 80% bucket 185: 10% bucket 134: 70% Sorting block time: 00:00:04 Returning block of 3378941 for bucket 159 bucket 126: 100% Sorting block of length 4367163 for bucket 126 (Using difference cover) bucket 145: 10% bucket 176: 50% bucket 171: 90% bucket 175: 60% bucket 120: 100% Sorting block of length 3964072 for bucket 120 (Using difference cover) bucket 127: 80% bucket 136: 60% bucket 179: 40% Getting block 190 of 210 Reserving size (4425267) for bucket 190 Calculating Z arrays for bucket 190 Entering block accumulator loop for bucket 190: bucket 137: 50% bucket 131: 80% bucket 180: 40% bucket 186: 10% bucket 173: 70% bucket 178: 50% Sorting block time: 00:00:01 Returning block of 1842545 for bucket 123 bucket 142: 20% bucket 144: 20% Getting block 148 of 199 Reserving size (4425267) for bucket 148 Calculating Z arrays for bucket 148 Entering block accumulator loop for bucket 148: bucket 133: 70% bucket 138: 40% bucket 177: 60% bucket 188: 10% bucket 187: 10% bucket 170: 100% Sorting block of length 3744831 for bucket 170 (Using difference cover) bucket 189: 10% bucket 129: 80% bucket 140: 30% bucket 125: 90% bucket 135: 80% bucket 171: 100% Sorting block of length 3313328 for bucket 171 (Using difference cover) bucket 172: 90% bucket 130: 80% bucket 139: 30% bucket 182: 30% bucket 184: 20% bucket 183: 30% bucket 174: 90% bucket 181: 40% Sorting block time: 00:00:02 Returning block of 2428603 for bucket 164 bucket 124: 100% Sorting block of length 4335473 for bucket 124 (Using difference cover) Getting block 191 of 210 Reserving size (4425267) for bucket 191 Calculating Z arrays for bucket 191 Entering block accumulator loop for bucket 191: Sorting block time: 00:00:02 Returning block of 2883281 for bucket 167 bucket 185: 20% bucket 146: 10% Sorting block time: 00:00:04 Returning block of 4000233 for bucket 168 Getting block 192 of 210 Reserving size (4425267) for bucket 192 Calculating Z arrays for bucket 192 Entering block accumulator loop for bucket 192: bucket 179: 50% Sorting block time: 00:00:04 Returning block of 3946035 for bucket 161 bucket 176: 60% Getting block 193 of 210 Reserving size (4425267) for bucket 193 Calculating Z arrays for bucket 193 Entering block accumulator loop for bucket 193: bucket 175: 70% Getting block 194 of 210 Reserving size (4425267) for bucket 194 Calculating Z arrays for bucket 194 Entering block accumulator loop for bucket 194: bucket 180: 50% bucket 177: 70% bucket 190: 10% bucket 137: 60% bucket 143: 30% bucket 173: 80% bucket 186: 20% Sorting block time: 00:00:03 Returning block of 3323914 for bucket 166 bucket 134: 80% bucket 147: 10% bucket 131: 90% bucket 132: 80% bucket 127: 90% bucket 188: 20% bucket 178: 60% Getting block 195 of 210 Reserving size (4425267) for bucket 195 Calculating Z arrays for bucket 195 Entering block accumulator loop for bucket 195: bucket 145: 20% bucket 187: 20% Sorting block time: 00:00:03 Returning block of 3852937 for bucket 122 bucket 128: 90% bucket 141: 30% Sorting block time: 00:00:02 Returning block of 3964073 for bucket 120 Getting block 149 of 199 Reserving size (4425267) for bucket 149 Calculating Z arrays for bucket 149 Entering block accumulator loop for bucket 149: bucket 189: 20% bucket 142: 30% Getting block 150 of 199 Reserving size (4425267) for bucket 150 Calculating Z arrays for bucket 150 Entering block accumulator loop for bucket 150: bucket 138: 50% bucket 133: 80% bucket 172: 100% Sorting block of length 2919502 for bucket 172 (Using difference cover) bucket 174: 100% Sorting block of length 3750705 for bucket 174 (Using difference cover) bucket 136: 70% bucket 183: 40% bucket 184: 30% bucket 177: 80% bucket 129: 90% bucket 125: 100% Sorting block of length 3447690 for bucket 125 (Using difference cover) bucket 182: 40% bucket 191: 10% Sorting block time: 00:00:04 Returning block of 4182137 for bucket 169 bucket 192: 10% bucket 185: 30% bucket 181: 50% bucket 188: 30% Getting block 196 of 210 Reserving size (4425267) for bucket 196 Calculating Z arrays for bucket 196 Entering block accumulator loop for bucket 196: bucket 179: 60% bucket 193: 10% bucket 148: 10% bucket 176: 70% Sorting block time: 00:00:02 Returning block of 3744832 for bucket 170 bucket 135: 90% Sorting block time: 00:00:03 Returning block of 3313329 for bucket 171 Getting block 197 of 210 Reserving size (4425267) for bucket 197 Calculating Z arrays for bucket 197 Entering block accumulator loop for bucket 197: bucket 175: 80% bucket 180: 60% bucket 194: 10% bucket 130: 90% Getting block 198 of 210 Reserving size (4425267) for bucket 198 Calculating Z arrays for bucket 198 Entering block accumulator loop for bucket 198: bucket 190: 20% bucket 144: 30% bucket 186: 30% bucket 178: 70% bucket 173: 90% Sorting block time: 00:00:04 Returning block of 4367164 for bucket 126 bucket 143: 40% bucket 140: 40% Getting block 151 of 199 Reserving size (4425267) for bucket 151 Calculating Z arrays for bucket 151 Entering block accumulator loop for bucket 151: bucket 187: 30% bucket 195: 10% bucket 183: 50% bucket 146: 20% bucket 137: 70% bucket 134: 90% bucket 139: 40% bucket 131: 100% Sorting block of length 2625289 for bucket 131 (Using difference cover) bucket 189: 30% bucket 184: 40% bucket 132: 90% Sorting block time: 00:00:04 Returning block of 4335474 for bucket 124 bucket 196: 10% bucket 127: 100% Sorting block of length 946079 for bucket 127 (Using difference cover) bucket 177: 90% bucket 149: 10% bucket 192: 20% Getting block 152 of 199 Reserving size (4425267) for bucket 152 Calculating Z arrays for bucket 152 Entering block accumulator loop for bucket 152: bucket 191: 20% bucket 128: 100% Sorting block of length 4126532 for bucket 128 (Using difference cover) bucket 197: 10% bucket 182: 50% bucket 188: 40% bucket 181: 60% bucket 185: 40% bucket 142: 40% bucket 193: 20% bucket 147: 20% bucket 145: 30% bucket 175: 90% bucket 150: 10% bucket 179: 70% Sorting block time: 00:00:02 Returning block of 2919503 for bucket 172 bucket 176: 80% Sorting block time: 00:00:02 Returning block of 3750706 for bucket 174 Getting block 199 of 210 Reserving size (4425267) for bucket 199 Calculating Z arrays for bucket 199 Entering block accumulator loop for bucket 199: bucket 198: 10% bucket 136: 80% bucket 183: 60% Getting block 200 of 210 Reserving size (4425267) for bucket 200 Calculating Z arrays for bucket 200 Entering block accumulator loop for bucket 200: bucket 194: 20% Sorting block time: 00:00:01 Returning block of 946080 for bucket 127 bucket 180: 70% Getting block 153 of 199 Reserving size (4425267) for bucket 153 Calculating Z arrays for bucket 153 Entering block accumulator loop for bucket 153: bucket 173: 100% Sorting block of length 4037999 for bucket 173 (Using difference cover) bucket 190: 30% bucket 133: 90% bucket 138: 60% bucket 186: 40% bucket 178: 80% bucket 129: 100% Sorting block of length 3163480 for bucket 129 (Using difference cover) bucket 141: 40% bucket 187: 40% Sorting block time: 00:00:03 Returning block of 3447691 for bucket 125 bucket 135: 100% Sorting block of length 3861599 for bucket 135 (Using difference cover) bucket 144: 40% bucket 195: 20% Getting block 154 of 199 Reserving size (4425267) for bucket 154 Calculating Z arrays for bucket 154 Entering block accumulator loop for bucket 154: bucket 184: 50% bucket 197: 20% bucket 196: 20% bucket 148: 20% bucket 189: 40% Sorting block time: 00:00:02 Returning block of 2625290 for bucket 131 bucket 177: 100% Sorting block of length 2470054 for bucket 177 (Using difference cover) bucket 143: 50% bucket 132: 100% Sorting block of length 2499935 for bucket 132 (Using difference cover) bucket 130: 100% Sorting block of length 3220746 for bucket 130 (Using difference cover) bucket 192: 30% Getting block 155 of 199 Reserving size (4425267) for bucket 155 Calculating Z arrays for bucket 155 Entering block accumulator loop for bucket 155: bucket 198: 20% bucket 139: 50% bucket 137: 80% bucket 188: 50% bucket 191: 30% bucket 182: 60% bucket 181: 70% bucket 193: 30% bucket 200: 10% bucket 151: 10% bucket 179: 80% bucket 199: 10% bucket 134: 100% Sorting block of length 3482917 for bucket 134 (Using difference cover) bucket 185: 50% bucket 184: 60% bucket 176: 90% bucket 183: 70% bucket 140: 50% bucket 175: 100% Sorting block of length 3919294 for bucket 175 (Using difference cover) bucket 152: 10% bucket 194: 30% bucket 190: 40% bucket 146: 30% bucket 197: 30% bucket 178: 90% bucket 136: 90% bucket 150: 20% bucket 187: 50% bucket 138: 70% bucket 180: 80% bucket 147: 30% bucket 149: 20% bucket 186: 50% bucket 142: 50% bucket 195: 30% bucket 196: 30% bucket 145: 40% bucket 198: 30% bucket 192: 40% bucket 141: 50% bucket 199: 20% bucket 200: 20% bucket 189: 50% bucket 188: 60% bucket 184: 70% bucket 191: 40% Sorting block time: 00:00:02 Returning block of 2470055 for bucket 177 Sorting block time: 00:00:03 Returning block of 3163481 for bucket 129 bucket 182: 70% bucket 193: 40% bucket 133: 100% Sorting block of length 2751282 for bucket 133 (Using difference cover) bucket 179: 90% Getting block 201 of 210 Reserving size (4425267) for bucket 201 Calculating Z arrays for bucket 201 Entering block accumulator loop for bucket 201: bucket 153: 10% Getting block 156 of 199 Reserving size (4425267) for bucket 156 Calculating Z arrays for bucket 156 Entering block accumulator loop for bucket 156: bucket 181: 80% Sorting block time: 00:00:03 Returning block of 2499936 for bucket 132 bucket 185: 60% bucket 183: 80% Sorting block time: 00:00:04 Returning block of 4126533 for bucket 128 Getting block 157 of 199 Reserving size (4425267) for bucket 157 Calculating Z arrays for bucket 157 Entering block accumulator loop for bucket 157: bucket 176: 100% Sorting block of length 4323970 for bucket 176 (Using difference cover) bucket 144: 50% bucket 154: 10% bucket 143: 60% Getting block 158 of 199 Reserving size (4425267) for bucket 158 Calculating Z arrays for bucket 158 Entering block accumulator loop for bucket 158: bucket 194: 40% bucket 192: 50% bucket 139: 60% bucket 197: 40% bucket 151: 20% bucket 155: 10% Sorting block time: 00:00:03 Returning block of 4038000 for bucket 173 bucket 148: 30% bucket 137: 90% Sorting block time: 00:00:03 Returning block of 3220747 for bucket 130 bucket 190: 50% bucket 145: 50% bucket 178: 100% Sorting block of length 3835907 for bucket 178 (Using difference cover) Getting block 202 of 210 Reserving size (4425267) for bucket 202 Calculating Z arrays for bucket 202 Entering block accumulator loop for bucket 202: bucket 187: 60% Getting block 159 of 199 Reserving size (4425267) for bucket 159 Calculating Z arrays for bucket 159 Entering block accumulator loop for bucket 159: bucket 198: 40% bucket 200: 30% bucket 199: 30% bucket 196: 40% bucket 152: 20% bucket 140: 60% bucket 180: 90% bucket 195: 40% bucket 186: 60% bucket 184: 80% bucket 189: 60% bucket 150: 30% bucket 138: 80% bucket 146: 40% bucket 188: 70% bucket 191: 50% bucket 147: 40% bucket 201: 10% bucket 179: 100% Sorting block of length 3211921 for bucket 179 (Using difference cover) bucket 149: 30% bucket 193: 50% bucket 182: 80% bucket 183: 90% bucket 136: 100% Sorting block of length 3134056 for bucket 136 (Using difference cover) bucket 185: 70% bucket 199: 40% bucket 181: 90% bucket 197: 50% bucket 194: 50% bucket 192: 60% bucket 184: 90% bucket 142: 60% Sorting block time: 00:00:05 Returning block of 3861600 for bucket 135 Sorting block time: 00:00:04 Returning block of 3482918 for bucket 134 bucket 153: 20% bucket 157: 10% Sorting block time: 00:00:02 Returning block of 2751283 for bucket 133 bucket 200: 40% Getting block 160 of 199 Reserving size (4425267) for bucket 160 Calculating Z arrays for bucket 160 Entering block accumulator loop for bucket 160: Getting block 161 of 199 Reserving size (4425267) for bucket 161 Calculating Z arrays for bucket 161 Entering block accumulator loop for bucket 161: bucket 137: 100% Sorting block of length 4277462 for bucket 137 (Using difference cover) Sorting block time: 00:00:04 Returning block of 3919295 for bucket 175 Getting block 162 of 199 Reserving size (4425267) for bucket 162 Calculating Z arrays for bucket 162 Entering block accumulator loop for bucket 162: bucket 196: 50% bucket 202: 10% bucket 198: 50% bucket 145: 60% bucket 183: 100% Sorting block of length 834011 for bucket 183 (Using difference cover) bucket 190: 60% bucket 144: 60% bucket 187: 70% Getting block 203 of 210 Reserving size (4425267) for bucket 203 Calculating Z arrays for bucket 203 Entering block accumulator loop for bucket 203: bucket 141: 60% bucket 195: 50% bucket 143: 70% bucket 156: 10% bucket 188: 80% bucket 186: 70% bucket 151: 30% bucket 158: 10% bucket 154: 20% bucket 180: 100% Sorting block of length 3347578 for bucket 180 (Using difference cover) bucket 139: 70% bucket 197: 60% Sorting block time: 00:00:01 Returning block of 834012 for bucket 183 bucket 201: 20% Getting block 204 of 210 Reserving size (4425267) for bucket 204 Calculating Z arrays for bucket 204 Entering block accumulator loop for bucket 204: bucket 191: 60% bucket 189: 70% bucket 148: 40% bucket 140: 70% bucket 193: 60% bucket 199: 50% bucket 182: 90% bucket 152: 30% bucket 155: 20% bucket 185: 80% bucket 159: 10% bucket 181: 100% Sorting block of length 3670531 for bucket 181 (Using difference cover) bucket 200: 50% bucket 192: 70% bucket 198: 60% bucket 150: 40% bucket 196: 60% bucket 184: 100% Sorting block of length 3857630 for bucket 184 (Using difference cover) bucket 138: 90% bucket 194: 60% bucket 146: 50% bucket 188: 90% Sorting block time: 00:00:03 Returning block of 3134057 for bucket 136 bucket 149: 40% Getting block 163 of 199 Reserving size (4425267) for bucket 163 Calculating Z arrays for bucket 163 Entering block accumulator loop for bucket 163: bucket 190: 70% bucket 142: 70% bucket 143: 80% bucket 187: 80% bucket 203: 10% bucket 202: 20% bucket 147: 50% Sorting block time: 00:00:02 Returning block of 4277463 for bucket 137 bucket 195: 60% bucket 160: 10% bucket 201: 30% bucket 186: 80% bucket 144: 70% Sorting block time: 00:00:04 Returning block of 4323971 for bucket 176 bucket 145: 70% bucket 197: 70% Getting block 164 of 199 Reserving size (4425267) for bucket 164 Calculating Z arrays for bucket 164 Entering block accumulator loop for bucket 164: bucket 204: 10% Sorting block time: 00:00:04 Returning block of 3211922 for bucket 179 Sorting block time: 00:00:05 Returning block of 3835908 for bucket 178 bucket 199: 60% bucket 161: 10% Getting block 205 of 210 Reserving size (4425267) for bucket 205 Calculating Z arrays for bucket 205 Entering block accumulator loop for bucket 205: bucket 191: 70% Getting block 206 of 210 Reserving size (4425267) for bucket 206 Calculating Z arrays for bucket 206 Entering block accumulator loop for bucket 206: Getting block 207 of 210 Reserving size (4425267) for bucket 207 Calculating Z arrays for bucket 207 Entering block accumulator loop for bucket 207: bucket 162: 10% bucket 151: 40% bucket 141: 70% bucket 157: 20% bucket 200: 60% bucket 153: 30% bucket 156: 20% bucket 189: 80% bucket 193: 70% bucket 198: 70% bucket 196: 70% bucket 185: 90% bucket 182: 100% Sorting block of length 4318862 for bucket 182 (Using difference cover) bucket 192: 80% bucket 188: 100% Sorting block of length 3575489 for bucket 188 (Using difference cover) bucket 154: 30% bucket 139: 80% bucket 158: 20% bucket 140: 80% bucket 194: 70% bucket 201: 40% bucket 197: 80% bucket 152: 40% bucket 159: 20% bucket 146: 60% Sorting block time: 00:00:03 Returning block of 3347579 for bucket 180 bucket 203: 20% bucket 204: 20% bucket 198: 80% bucket 195: 70% bucket 187: 90% bucket 186: 90% bucket 199: 70% bucket 143: 90% Getting block 208 of 210 Reserving size (4425267) for bucket 208 Calculating Z arrays for bucket 208 Entering block accumulator loop for bucket 208: bucket 190: 80% bucket 155: 30% bucket 202: 30% bucket 149: 50% bucket 150: 50% bucket 144: 80% bucket 200: 70% bucket 192: 90% bucket 191: 80% bucket 138: 100% Sorting block of length 3372347 for bucket 138 (Using difference cover) bucket 148: 50% bucket 205: 10% bucket 206: 10% bucket 196: 80% Sorting block time: 00:00:03 Returning block of 3857631 for bucket 184 bucket 207: 10% bucket 142: 80% bucket 151: 50% Getting block 209 of 210 Reserving size (4425267) for bucket 209 Calculating Z arrays for bucket 209 Entering block accumulator loop for bucket 209: bucket 185: 100% Sorting block of length 4263411 for bucket 185 (Using difference cover) bucket 160: 20% bucket 201: 50% bucket 193: 80% bucket 189: 90% bucket 161: 20% bucket 198: 90% bucket 153: 40% bucket 147: 60% bucket 162: 20% bucket 157: 30% bucket 141: 80% bucket 194: 80% bucket 164: 10% bucket 197: 90% bucket 139: 90% Sorting block time: 00:00:04 Returning block of 3670532 for bucket 181 bucket 154: 40% Getting block 210 of 210 Reserving size (4425267) for bucket 210 Calculating Z arrays for bucket 210 Entering block accumulator loop for bucket 210: bucket 145: 80% bucket 204: 30% bucket 163: 10% bucket 199: 80% bucket 195: 80% bucket 156: 30% bucket 186: 100% Sorting block of length 4291627 for bucket 186 (Using difference cover) bucket 203: 30% bucket 187: 100% Sorting block of length 2523943 for bucket 187 (Using difference cover) bucket 209: 10% bucket 190: 90% bucket 208: 10% bucket 140: 90% bucket 149: 60% bucket 152: 50% bucket 200: 80% bucket 192: 100% Sorting block of length 2402782 for bucket 192 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3575490 for bucket 188 bucket 158: 30% bucket 202: 40% bucket 144: 90% bucket 150: 60% bucket 201: 60% bucket 191: 90% bucket 196: 90% bucket 207: 20% bucket 204: 40% bucket 205: 20% bucket 198: 100% Sorting block of length 2512625 for bucket 198 (Using difference cover) bucket 197: 100% Sorting block of length 3118324 for bucket 197 (Using difference cover) bucket 146: 70% bucket 159: 30% bucket 193: 90% bucket 206: 20% bucket 143: 100% Sorting block of length 4178694 for bucket 143 (Using difference cover) Sorting block time: 00:00:04 Returning block of 4318863 for bucket 182 bucket 189: 100% Sorting block of length 4179882 for bucket 189 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3372348 for bucket 138 bucket 194: 90% bucket 148: 60% bucket 141: 90% Getting block 165 of 199 Reserving size (4425267) for bucket 165 Calculating Z arrays for bucket 165 Entering block accumulator loop for bucket 165: bucket 210: 10% bucket 160: 30% bucket 209: 20% bucket 199: 90% bucket 155: 40% bucket 190: 100% Sorting block of length 3617075 for bucket 190 (Using difference cover) bucket 195: 90% bucket 200: 90% bucket 147: 70% bucket 161: 30% bucket 153: 50% bucket 162: 30% bucket 157: 40% bucket 154: 50% Sorting block time: 00:00:01 Returning block of 2512626 for bucket 198 bucket 196: 100% Sorting block of length 3901609 for bucket 196 (Using difference cover) bucket 142: 90% bucket 203: 40% bucket 201: 70% bucket 204: 50% bucket 208: 20% bucket 191: 100% Sorting block of length 1107488 for bucket 191 (Using difference cover) bucket 151: 60% bucket 202: 50% bucket 156: 40% bucket 145: 90% bucket 207: 30% bucket 139: 100% Sorting block of length 4153756 for bucket 139 (Using difference cover) bucket 205: 30% bucket 193: 100% Sorting block of length 3153957 for bucket 193 (Using difference cover) bucket 206: 30% Sorting block time: 00:00:03 Returning block of 2402783 for bucket 192 bucket 209: 30% bucket 210: 20% Sorting block time: 00:00:03 Returning block of 2523944 for bucket 187 Sorting block time: 00:00:04 Returning block of 4263412 for bucket 185 bucket 149: 70% bucket 194: 100% Sorting block of length 3193306 for bucket 194 (Using difference cover) bucket 150: 70% bucket 164: 20% Sorting block time: 00:00:01 Returning block of 1107489 for bucket 191 bucket 199: 100% Sorting block of length 3617452 for bucket 199 (Using difference cover) bucket 195: 100% Sorting block of length 2370935 for bucket 195 (Using difference cover) bucket 163: 20% bucket 140: 100% Sorting block of length 4415474 for bucket 140 (Using difference cover) bucket 152: 60% bucket 158: 40% bucket 200: 100% Sorting block of length 2917084 for bucket 200 (Using difference cover) bucket 159: 40% bucket 146: 80% bucket 160: 40% bucket 209: 40% bucket 203: 50% Sorting block time: 00:00:03 Returning block of 4178695 for bucket 143 bucket 204: 60% bucket 201: 80% bucket 208: 30% Sorting block time: 00:00:03 Returning block of 3118325 for bucket 197 bucket 202: 60% bucket 210: 30% Getting block 166 of 199 Reserving size (4425267) for bucket 166 Calculating Z arrays for bucket 166 Entering block accumulator loop for bucket 166: bucket 207: 40% bucket 155: 50% bucket 205: 40% bucket 206: 40% Sorting block time: 00:00:04 Returning block of 4291628 for bucket 186 bucket 144: 100% Sorting block of length 3337035 for bucket 144 (Using difference cover) bucket 141: 100% Sorting block of length 1204071 for bucket 141 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4179883 for bucket 189 bucket 162: 40% bucket 203: 60% bucket 208: 40% bucket 147: 80% bucket 161: 40% bucket 154: 60% bucket 148: 70% Sorting block time: 00:00:04 Returning block of 3617076 for bucket 190 bucket 210: 40% bucket 153: 60% bucket 204: 70% bucket 201: 90% bucket 165: 10% Sorting block time: 00:00:03 Returning block of 3153958 for bucket 193 bucket 157: 50% bucket 156: 50% bucket 202: 70% Sorting block time: 00:00:02 Returning block of 3193307 for bucket 194 bucket 209: 50% Sorting block time: 00:00:03 Returning block of 3901610 for bucket 196 Sorting block time: 00:00:02 Returning block of 2370936 for bucket 195 bucket 207: 50% bucket 205: 50% bucket 206: 50% bucket 159: 50% Sorting block time: 00:00:03 Returning block of 4153757 for bucket 139 Sorting block time: 00:00:02 Returning block of 1204072 for bucket 141 bucket 150: 80% Getting block 167 of 199 Reserving size (4425267) for bucket 167 Calculating Z arrays for bucket 167 Entering block accumulator loop for bucket 167: bucket 164: 30% Getting block 168 of 199 Reserving size (4425267) for bucket 168 Calculating Z arrays for bucket 168 Entering block accumulator loop for bucket 168: bucket 142: 100% Sorting block of length 3661261 for bucket 142 (Using difference cover) Sorting block time: 00:00:03 Returning block of 2917085 for bucket 200 bucket 151: 70% bucket 208: 50% bucket 149: 80% bucket 210: 50% bucket 203: 70% Sorting block time: 00:00:03 Returning block of 3617453 for bucket 199 bucket 204: 80% bucket 201: 100% Sorting block of length 2333955 for bucket 201 (Using difference cover) bucket 146: 90% bucket 158: 50% bucket 202: 80% bucket 145: 100% Sorting block of length 1820581 for bucket 145 (Using difference cover) bucket 152: 70% bucket 207: 60% bucket 160: 50% bucket 166: 10% bucket 209: 60% bucket 161: 50% bucket 155: 60% bucket 163: 30% bucket 205: 60% bucket 162: 50% bucket 206: 60% bucket 153: 70% Sorting block time: 00:00:03 Returning block of 3337036 for bucket 144 bucket 208: 60% Getting block 169 of 199 Reserving size (4425267) for bucket 169 Calculating Z arrays for bucket 169 Entering block accumulator loop for bucket 169: bucket 210: 60% bucket 147: 90% Sorting block time: 00:00:01 Returning block of 1820582 for bucket 145 bucket 159: 60% bucket 154: 70% bucket 204: 90% Getting block 170 of 199 Reserving size (4425267) for bucket 170 Calculating Z arrays for bucket 170 Entering block accumulator loop for bucket 170: bucket 156: 60% Sorting block time: 00:00:04 Returning block of 4415475 for bucket 140 bucket 209: 70% bucket 157: 60% bucket 205: 70% bucket 203: 80% bucket 165: 20% bucket 148: 80% bucket 207: 70% Getting block 171 of 199 Reserving size (4425267) for bucket 171 Calculating Z arrays for bucket 171 Entering block accumulator loop for bucket 171: bucket 164: 40% bucket 210: 70% bucket 202: 90% bucket 151: 80% Sorting block time: 00:00:02 Returning block of 2333956 for bucket 201 bucket 208: 70% bucket 206: 70% bucket 150: 90% bucket 152: 80% bucket 204: 100% Sorting block of length 2338537 for bucket 204 (Using difference cover) bucket 209: 80% bucket 149: 90% bucket 167: 10% bucket 161: 60% bucket 155: 70% bucket 160: 60% bucket 146: 100% Sorting block of length 1845532 for bucket 146 (Using difference cover) bucket 168: 10% bucket 210: 80% Sorting block time: 00:00:02 Returning block of 3661262 for bucket 142 bucket 158: 60% Getting block 172 of 199 Reserving size (4425267) for bucket 172 Calculating Z arrays for bucket 172 Entering block accumulator loop for bucket 172: bucket 207: 80% bucket 153: 80% bucket 208: 80% bucket 163: 40% bucket 162: 60% bucket 159: 70% bucket 205: 80% bucket 203: 90% bucket 202: 100% Sorting block of length 4142401 for bucket 202 (Using difference cover) bucket 206: 80% Sorting block time: 00:00:01 Returning block of 1845533 for bucket 146 bucket 157: 70% bucket 209: 90% bucket 166: 20% bucket 156: 70% Getting block 173 of 199 Reserving size (4425267) for bucket 173 Calculating Z arrays for bucket 173 Entering block accumulator loop for bucket 173: bucket 210: 90% bucket 154: 80% bucket 169: 10% bucket 148: 90% bucket 164: 50% bucket 147: 100% Sorting block of length 3031770 for bucket 147 (Using difference cover) bucket 208: 90% bucket 150: 100% Sorting block of length 3949742 for bucket 150 (Using difference cover) bucket 207: 90% bucket 152: 90% bucket 170: 10% bucket 171: 10% bucket 149: 100% Sorting block of length 4346735 for bucket 149 (Using difference cover) bucket 161: 70% bucket 165: 30% bucket 210: 100% Sorting block of length 4969870 for bucket 210 (Using difference cover) bucket 205: 90% bucket 203: 100% Sorting block of length 4147311 for bucket 203 (Using difference cover) bucket 155: 80% bucket 160: 70% Sorting block time: 00:00:02 Returning block of 2338538 for bucket 204 bucket 209: 100% Sorting block of length 663425 for bucket 209 (Using difference cover) bucket 158: 70% bucket 206: 90% bucket 151: 90% bucket 168: 20% bucket 159: 80% bucket 167: 20% bucket 207: 100% Sorting block of length 4010207 for bucket 207 (Using difference cover) bucket 153: 90% bucket 172: 10% Sorting block time: 00:00:01 Returning block of 3031771 for bucket 147 Getting block 174 of 199 Reserving size (4425267) for bucket 174 Calculating Z arrays for bucket 174 Entering block accumulator loop for bucket 174: bucket 208: 100% Sorting block of length 940496 for bucket 208 (Using difference cover) Sorting block time: 00:00:01 Returning block of 663426 for bucket 209 bucket 205: 100% Sorting block of length 1507415 for bucket 205 (Using difference cover) bucket 162: 70% bucket 156: 80% bucket 173: 10% bucket 154: 90% bucket 206: 100% Sorting block of length 3556543 for bucket 206 (Using difference cover) bucket 166: 30% bucket 152: 100% Sorting block of length 4397300 for bucket 152 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4142402 for bucket 202 bucket 163: 50% Sorting block time: 00:00:02 Returning block of 3949743 for bucket 150 bucket 161: 80% bucket 169: 20% bucket 171: 20% Getting block 175 of 199 Reserving size (4425267) for bucket 175 Calculating Z arrays for bucket 175 Entering block accumulator loop for bucket 175: bucket 155: 90% bucket 164: 60% bucket 160: 80% bucket 157: 80% bucket 148: 100% Sorting block of length 1190415 for bucket 148 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4346736 for bucket 149 Sorting block time: 00:00:00 Returning block of 1507416 for bucket 205 bucket 165: 40% bucket 170: 20% Getting block 176 of 199 Reserving size (4425267) for bucket 176 Calculating Z arrays for bucket 176 Entering block accumulator loop for bucket 176: bucket 159: 90% bucket 153: 100% Sorting block of length 3315283 for bucket 153 (Using difference cover) bucket 158: 80% Sorting block time: 00:00:03 Returning block of 4147312 for bucket 203 Sorting block time: 00:00:01 Returning block of 1190416 for bucket 148 bucket 173: 20% Getting block 177 of 199 Reserving size (4425267) for bucket 177 Calculating Z arrays for bucket 177 Entering block accumulator loop for bucket 177: bucket 162: 80% Sorting block time: 00:00:02 Returning block of 940497 for bucket 208 bucket 168: 30% bucket 154: 100% Sorting block of length 3769547 for bucket 154 (Using difference cover) bucket 151: 100% Sorting block of length 1212389 for bucket 151 (Using difference cover) bucket 156: 90% bucket 167: 30% bucket 172: 20% bucket 174: 10% bucket 166: 40% bucket 161: 90% bucket 155: 100% Sorting block of length 1918117 for bucket 155 (Using difference cover) bucket 163: 60% bucket 160: 90% Sorting block time: 00:00:03 Returning block of 4010208 for bucket 207 Sorting block time: 00:00:02 Returning block of 4397301 for bucket 152 bucket 175: 10% bucket 164: 70% bucket 157: 90% bucket 169: 30% Getting block 178 of 199 Reserving size (4425267) for bucket 178 Calculating Z arrays for bucket 178 Entering block accumulator loop for bucket 178: Sorting block time: 00:00:02 Returning block of 3556544 for bucket 206 Sorting block time: 00:00:01 Returning block of 1212390 for bucket 151 bucket 171: 30% Getting block 179 of 199 Reserving size (4425267) for bucket 179 Calculating Z arrays for bucket 179 Entering block accumulator loop for bucket 179: bucket 159: 100% Sorting block of length 4247003 for bucket 159 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3315284 for bucket 153 bucket 173: 30% Getting block 180 of 199 Reserving size (4425267) for bucket 180 Calculating Z arrays for bucket 180 Entering block accumulator loop for bucket 180: bucket 162: 90% Sorting block time: 00:00:01 Returning block of 1918118 for bucket 155 Getting block 181 of 199 Reserving size (4425267) for bucket 181 Calculating Z arrays for bucket 181 Entering block accumulator loop for bucket 181: Sorting block time: 00:00:02 Returning block of 3769548 for bucket 154 Getting block 182 of 199 Reserving size (4425267) for bucket 182 Calculating Z arrays for bucket 182 Entering block accumulator loop for bucket 182: bucket 156: 100% Sorting block of length 2841210 for bucket 156 (Using difference cover) bucket 165: 50% bucket 168: 40% bucket 158: 90% bucket 170: 30% bucket 177: 10% bucket 161: 100% Sorting block of length 932609 for bucket 161 (Using difference cover) Sorting block time: 00:00:01 Returning block of 4247004 for bucket 159 Sorting block time: 00:00:00 Returning block of 932610 for bucket 161 Getting block 183 of 199 Reserving size (4425267) for bucket 183 Calculating Z arrays for bucket 183 Entering block accumulator loop for bucket 183: Getting block 184 of 199 Reserving size (4425267) for bucket 184 Calculating Z arrays for bucket 184 Entering block accumulator loop for bucket 184: Sorting block time: 00:00:02 Returning block of 2841211 for bucket 156 bucket 176: 10% bucket 175: 20% bucket 172: 30% bucket 160: 100% Sorting block of length 4046048 for bucket 160 (Using difference cover) bucket 167: 40% Getting block 185 of 199 Reserving size (4425267) for bucket 185 Calculating Z arrays for bucket 185 Entering block accumulator loop for bucket 185: bucket 157: 100% Sorting block of length 4360929 for bucket 157 (Using difference cover) bucket 179: 10% bucket 174: 20% bucket 178: 10% bucket 173: 40% bucket 162: 100% Sorting block of length 4417504 for bucket 162 (Using difference cover) bucket 180: 10% Sorting block time: 00:00:07 Returning block of 4969871 for bucket 210 bucket 166: 50% Exited Ebwt loop fchr[A]: 0 fchr[C]: 197284975 fchr[G]: 197284975 fchr[T]: 330645804 fchr[$]: 660839850 bucket 163: 70% Exiting Ebwt::buildToDisk() bucket 182: 10% Returning from initFromVector Wrote 224523443 bytes to primary EBWT file: BS_CT.1.bt2 Wrote 165209968 bytes to secondary EBWT file: BS_CT.2.bt2 Re-opening _in1 and _in2 as input streams Returning from Ebwt constructor Headers: len: 660839850 bwtLen: 660839851 sz: 165209963 bwtSz: 165209963 lineRate: 6 offRate: 4 offMask: 0xfffffff0 ftabChars: 10 eftabLen: 20 eftabSz: 80 ftabLen: 1048577 ftabSz: 4194308 offsLen: 41302491 offsSz: 165209964 lineSz: 64 sideSz: 64 sideBwtSz: 48 sideBwtLen: 192 numSides: 3441875 numLines: 3441875 ebwtTotLen: 220280000 ebwtTotSz: 220280000 color: 0 reverse: 0 Total time for call to driver() for forward index: 00:03:22 Reading reference sizes bucket 181: 10% bucket 164: 80% bucket 169: 40% bucket 171: 40% bucket 168: 50% bucket 165: 60% bucket 158: 100% Sorting block of length 2835077 for bucket 158 (Using difference cover) bucket 177: 20% bucket 170: 40% bucket 183: 10% bucket 184: 10% Sorting block time: 00:00:01 Returning block of 4046049 for bucket 160 bucket 176: 20% bucket 172: 40% Getting block 186 of 199 Reserving size (4425267) for bucket 186 Calculating Z arrays for bucket 186 Entering block accumulator loop for bucket 186: Sorting block time: 00:00:02 Returning block of 4360930 for bucket 157 bucket 175: 30% bucket 167: 50% Getting block 187 of 199 Reserving size (4425267) for bucket 187 Calculating Z arrays for bucket 187 Entering block accumulator loop for bucket 187: bucket 185: 10% bucket 174: 30% bucket 179: 20% bucket 166: 60% bucket 173: 50% bucket 178: 20% Sorting block time: 00:00:01 Returning block of 2835078 for bucket 158 Getting block 188 of 199 Reserving size (4425267) for bucket 188 Calculating Z arrays for bucket 188 Entering block accumulator loop for bucket 188: Sorting block time: 00:00:03 Returning block of 4417505 for bucket 162 bucket 163: 80% bucket 180: 20% Getting block 189 of 199 Reserving size (4425267) for bucket 189 Calculating Z arrays for bucket 189 Entering block accumulator loop for bucket 189: bucket 164: 90% bucket 171: 50% bucket 182: 20% bucket 169: 50% bucket 181: 20% bucket 165: 70% bucket 177: 30% bucket 168: 60% bucket 170: 50% bucket 172: 50% bucket 176: 30% bucket 183: 20% bucket 175: 40% bucket 184: 20% bucket 186: 10% bucket 167: 60% bucket 185: 20% bucket 187: 10% bucket 174: 40% bucket 166: 70% bucket 188: 10% bucket 163: 90% bucket 180: 30% bucket 179: 30% bucket 164: 100% Sorting block of length 1289971 for bucket 164 (Using difference cover) bucket 178: 30% bucket 173: 60% bucket 171: 60% bucket 189: 10% bucket 165: 80% Sorting block time: 00:00:00 Returning block of 1289972 for bucket 164 Getting block 190 of 199 Reserving size (4425267) for bucket 190 Calculating Z arrays for bucket 190 Entering block accumulator loop for bucket 190: bucket 177: 40% bucket 182: 30% bucket 181: 30% bucket 169: 60% bucket 170: 60% bucket 172: 60% bucket 176: 40% bucket 175: 50% Time reading reference sizes: 00:00:06 Calculating joined length Writing header Reserving space for joined string Joining reference sequences bucket 168: 70% bucket 167: 70% bucket 174: 50% bucket 183: 30% bucket 184: 30% bucket 166: 80% bucket 188: 20% bucket 186: 20% bucket 185: 30% bucket 187: 20% bucket 163: 100% Sorting block of length 4165347 for bucket 163 (Using difference cover) bucket 180: 40% bucket 171: 70% bucket 179: 40% bucket 189: 20% bucket 173: 70% bucket 178: 40% bucket 165: 90% bucket 177: 50% bucket 172: 70% bucket 170: 70% bucket 190: 10% bucket 176: 50% bucket 182: 40% bucket 169: 70% bucket 175: 60% bucket 181: 40% bucket 167: 80% bucket 174: 60% bucket 168: 80% bucket 184: 40% bucket 183: 40% bucket 186: 30% bucket 188: 30% bucket 185: 40% Sorting block time: 00:00:03 Returning block of 4165348 for bucket 163 bucket 187: 30% Getting block 191 of 199 Reserving size (4425267) for bucket 191 Calculating Z arrays for bucket 191 Entering block accumulator loop for bucket 191: bucket 166: 90% bucket 180: 50% bucket 189: 30% bucket 179: 50% bucket 173: 80% bucket 171: 80% bucket 178: 50% bucket 190: 20% bucket 177: 60% bucket 165: 100% Sorting block of length 3515899 for bucket 165 (Using difference cover) bucket 182: 50% bucket 181: 50% bucket 169: 80% bucket 172: 80% bucket 170: 80% bucket 176: 60% bucket 175: 70% bucket 184: 50% bucket 183: 50% bucket 168: 90% bucket 186: 40% bucket 185: 50% bucket 188: 40% bucket 174: 70% bucket 187: 40% bucket 167: 90% bucket 191: 10% bucket 166: 100% Sorting block of length 1875265 for bucket 166 (Using difference cover) bucket 180: 60% bucket 171: 90% bucket 189: 40% bucket 179: 60% bucket 173: 90% Sorting block time: 00:00:02 Returning block of 3515900 for bucket 165 Sorting block time: 00:00:01 Returning block of 1875266 for bucket 166 Getting block 192 of 199 Reserving size (4425267) for bucket 192 Calculating Z arrays for bucket 192 Entering block accumulator loop for bucket 192: Getting block 193 of 199 Reserving size (4425267) for bucket 193 Calculating Z arrays for bucket 193 Entering block accumulator loop for bucket 193: bucket 177: 70% bucket 178: 60% bucket 190: 30% bucket 172: 90% bucket 169: 90% bucket 175: 80% bucket 170: 90% bucket 176: 70% bucket 181: 60% bucket 182: 60% bucket 191: 20% bucket 185: 60% bucket 174: 80% bucket 167: 100% Sorting block of length 3962345 for bucket 167 (Using difference cover) bucket 184: 60% bucket 180: 70% bucket 188: 50% bucket 183: 60% bucket 186: 50% bucket 171: 100% Sorting block of length 3602127 for bucket 171 (Using difference cover) bucket 187: 50% bucket 168: 100% Sorting block of length 3986401 for bucket 168 (Using difference cover) Time to join reference sequences: 00:00:08 Time to reverse reference sequence: 00:00:00 bmax according to bmaxDivN setting: 5900355 Using parameters --bmax 4425267 --dcv 1024 Doing ahead-of-time memory usage test bucket 192: 10% bucket 193: 10% bucket 177: 80% bucket 189: 50% bucket 172: 100% Sorting block of length 3073480 for bucket 172 (Using difference cover) bucket 179: 70% bucket 173: 100% Sorting block of length 4137892 for bucket 173 (Using difference cover) bucket 169: 100% Sorting block of length 3126536 for bucket 169 (Using difference cover) bucket 175: 90% bucket 176: 80% bucket 170: 100% Sorting block of length 3688835 for bucket 170 (Using difference cover) Passed! Constructing with these parameters: --bmax 4425267 --dcv 1024 Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime bucket 178: 70% bucket 185: 70% Sorting block time: 00:00:02 Returning block of 3962346 for bucket 167 Getting block 194 of 199 Reserving size (4425267) for bucket 194 Calculating Z arrays for bucket 194 Entering block accumulator loop for bucket 194: bucket 191: 30% Building sPrimeOrder bucket 190: 40% V-Sorting samples bucket 174: 90% Sorting block time: 00:00:02 Returning block of 3602128 for bucket 171 Getting block 195 of 199 Reserving size (4425267) for bucket 195 Calculating Z arrays for bucket 195 Entering block accumulator loop for bucket 195: bucket 180: 80% bucket 181: 70% bucket 182: 70% Sorting block time: 00:00:02 Returning block of 3986402 for bucket 168 Getting block 196 of 199 Reserving size (4425267) for bucket 196 Calculating Z arrays for bucket 196 Entering block accumulator loop for bucket 196: bucket 184: 70% bucket 188: 60% bucket 183: 70% bucket 192: 20% bucket 193: 20% bucket 186: 60% Sorting block time: 00:00:01 Returning block of 3073481 for bucket 172 Getting block 197 of 199 Reserving size (4425267) for bucket 197 Calculating Z arrays for bucket 197 Entering block accumulator loop for bucket 197: bucket 187: 60% Sorting block time: 00:00:02 Returning block of 3126537 for bucket 169 Getting block 198 of 199 Reserving size (4425267) for bucket 198 Calculating Z arrays for bucket 198 Entering block accumulator loop for bucket 198: bucket 177: 90% Sorting block time: 00:00:02 Returning block of 3688836 for bucket 170 Sorting block time: 00:00:02 Returning block of 4137893 for bucket 173 Getting block 199 of 199 Reserving size (4425267) for bucket 199 Calculating Z arrays for bucket 199 Entering block accumulator loop for bucket 199: bucket 189: 60% bucket 175: 100% Sorting block of length 3882036 for bucket 175 (Using difference cover) bucket 176: 90% bucket 185: 80% bucket 194: 10% bucket 191: 40% bucket 179: 80% bucket 174: 100% Sorting block of length 3966369 for bucket 174 (Using difference cover) bucket 195: 10% bucket 180: 90% bucket 178: 80% bucket 190: 50% bucket 199: 10% Sorting block time: 00:00:02 Returning block of 3882037 for bucket 175 bucket 193: 30% bucket 192: 30% bucket 198: 10% bucket 184: 80% bucket 187: 70% bucket 197: 10% bucket 182: 80% bucket 177: 100% Sorting block of length 2153474 for bucket 177 (Using difference cover) bucket 183: 80% bucket 196: 10% bucket 181: 80% bucket 185: 90% bucket 176: 100% Sorting block of length 3062690 for bucket 176 (Using difference cover) bucket 188: 70% bucket 199: 20% Sorting block time: 00:00:02 Returning block of 3966370 for bucket 174 bucket 186: 70% bucket 179: 90% bucket 191: 50% bucket 195: 20% bucket 189: 70% bucket 198: 20% bucket 194: 20% bucket 180: 100% Sorting block of length 385240 for bucket 180 (Using difference cover) bucket 184: 90% bucket 178: 90% Sorting block time: 00:00:02 Returning block of 2153475 for bucket 177 Sorting block time: 00:00:01 Returning block of 3062691 for bucket 176 bucket 190: 60% Sorting block time: 00:00:00 Returning block of 385241 for bucket 180 bucket 192: 40% bucket 199: 30% bucket 185: 100% Sorting block of length 1401825 for bucket 185 (Using difference cover) bucket 193: 40% bucket 197: 20% bucket 183: 90% bucket 182: 90% V-Sorting samples time: 00:00:07 Allocating rank array Ranking v-sort output Sorting block time: 00:00:01 Returning block of 1401826 for bucket 185 bucket 187: 80% bucket 191: 60% bucket 196: 20% bucket 181: 90% bucket 188: 80% bucket 195: 30% bucket 198: 30% bucket 199: 40% bucket 186: 80% bucket 194: 30% bucket 189: 80% bucket 179: 100% Sorting block of length 3671545 for bucket 179 (Using difference cover) bucket 192: 50% bucket 190: 70% bucket 197: 30% bucket 184: 100% Sorting block of length 4340587 for bucket 184 (Using difference cover) bucket 178: 100% Sorting block of length 4375614 for bucket 178 (Using difference cover) bucket 193: 50% bucket 199: 50% Sorting block time: 00:00:02 Returning block of 3671546 for bucket 179 bucket 191: 70% bucket 187: 90% bucket 183: 100% Sorting block of length 3177816 for bucket 183 (Using difference cover) bucket 196: 30% bucket 195: 40% bucket 198: 40% bucket 182: 100% Sorting block of length 3105022 for bucket 182 (Using difference cover) bucket 194: 40% bucket 188: 90% bucket 181: 100% Sorting block of length 6891196 for bucket 181 (Using difference cover) bucket 186: 90% bucket 189: 90% Sorting block time: 00:00:02 Returning block of 4375615 for bucket 178 Ranking v-sort output time: 00:00:04 Invoking Larsson-Sadakane on ranks Sorting block time: 00:00:02 Returning block of 4340588 for bucket 184 bucket 190: 80% Sorting block time: 00:00:01 Returning block of 3105023 for bucket 182 Sorting block time: 00:00:01 Returning block of 3177817 for bucket 183 bucket 192: 60% bucket 199: 60% bucket 197: 40% bucket 187: 100% Sorting block of length 3575460 for bucket 187 (Using difference cover) bucket 196: 40% bucket 193: 60% bucket 195: 50% bucket 191: 80% bucket 198: 50% bucket 188: 100% Sorting block of length 3387519 for bucket 188 (Using difference cover) bucket 199: 70% bucket 186: 100% Sorting block of length 3468332 for bucket 186 (Using difference cover) bucket 194: 50% bucket 189: 100% Sorting block of length 3085799 for bucket 189 (Using difference cover) Sorting block time: 00:00:04 Returning block of 6891197 for bucket 181 Sorting block time: 00:00:02 Returning block of 3575461 for bucket 187 bucket 190: 90% bucket 192: 70% bucket 197: 50% Sorting block time: 00:00:02 Returning block of 3468333 for bucket 186 Sorting block time: 00:00:02 Returning block of 3387520 for bucket 188 Sorting block time: 00:00:02 Returning block of 3085800 for bucket 189 bucket 199: 80% bucket 195: 60% bucket 196: 50% bucket 193: 70% bucket 198: 60% bucket 194: 60% bucket 191: 90% bucket 199: 90% bucket 192: 80% bucket 197: 60% Invoking Larsson-Sadakane on ranks time: 00:00:06 Sanity-checking and returning Building samples Reserving space for 300 sample suffixes Generating random suffixes QSorting 300 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 300 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes bucket 190: 100% Sorting block of length 1772937 for bucket 190 (Using difference cover) bucket 195: 70% bucket 198: 70% bucket 196: 60% bucket 199: 100% Sorting block of length 3990721 for bucket 199 (Using difference cover) bucket 194: 70% bucket 193: 80% Sorting block time: 00:00:00 Returning block of 1772938 for bucket 190 bucket 192: 90% bucket 197: 70% bucket 191: 100% Sorting block of length 3529967 for bucket 191 (Using difference cover) bucket 198: 80% bucket 195: 80% bucket 194: 80% bucket 193: 90% bucket 196: 70% Sorting block time: 00:00:02 Returning block of 3990722 for bucket 199 bucket 197: 80% bucket 192: 100% Sorting block of length 3559664 for bucket 192 (Using difference cover) bucket 198: 90% bucket 194: 90% Sorting block time: 00:00:02 Returning block of 3529968 for bucket 191 bucket 195: 90% bucket 193: 100% Sorting block of length 4072455 for bucket 193 (Using difference cover) Splitting and merging Splitting and merging time: 00:00:00 Split 29, merged 130; iterating... Sorting block time: 00:00:01 Returning block of 3559665 for bucket 192 bucket 196: 80% bucket 197: 90% bucket 194: 100% Sorting block of length 4338277 for bucket 194 (Using difference cover) bucket 198: 100% Sorting block of length 905245 for bucket 198 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4072456 for bucket 193 bucket 195: 100% Sorting block of length 3508679 for bucket 195 (Using difference cover) Sorting block time: 00:00:01 Returning block of 905246 for bucket 198 bucket 196: 90% bucket 197: 100% Sorting block of length 4336023 for bucket 197 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4338278 for bucket 194 Splitting and merging Splitting and merging time: 00:00:00 Split 21, merged 13; iterating... Sorting block time: 00:00:02 Returning block of 3508680 for bucket 195 bucket 196: 100% Sorting block of length 2629197 for bucket 196 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4336024 for bucket 197 Sorting block time: 00:00:02 Returning block of 2629198 for bucket 196 Splitting and merging Splitting and merging time: 00:00:00 Split 13, merged 12; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 7, merged 8; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 4, merged 6; iterating... Avg bucket size: 3.20796e+06 (target: 4425266) Converting suffix-array elements to index image Allocating ftab, absorbFtab Entering Ebwt loop Getting block 1 of 206 Reserving size (4425267) for bucket 1 Getting block 2 of 206 Getting block 3 of 206 Getting block 4 of 206 Getting block 5 of 206 Getting block 6 of 206 Getting block 7 of 206 Getting block 8 of 206 Getting block 9 of 206 Getting block 10 of 206 Getting block 11 of 206 Getting block 12 of 206 Getting block 13 of 206 Getting block 14 of 206 Getting block 15 of 206 Getting block 16 of 206 Getting block 17 of 206 Getting block 18 of 206 Getting block 19 of 206 Getting block 20 of 206 Calculating Z arrays for bucket 1 Reserving size (4425267) for bucket 2 Reserving size (4425267) for bucket 3 Reserving size (4425267) for bucket 4 Getting block 21 of 206 Reserving size (4425267) for bucket 5 Getting block 22 of 206 Reserving size (4425267) for bucket 6 Reserving size (4425267) for bucket 7 Reserving size (4425267) for bucket 8 Getting block 23 of 206 Reserving size (4425267) for bucket 9 Reserving size (4425267) for bucket 10 Reserving size (4425267) for bucket 11 Reserving size (4425267) for bucket 12 Reserving size (4425267) for bucket 13 Reserving size (4425267) for bucket 14 Reserving size (4425267) for bucket 15 Reserving size (4425267) for bucket 16 Reserving size (4425267) for bucket 17 Reserving size (4425267) for bucket 18 Reserving size (4425267) for bucket 19 Reserving size (4425267) for bucket 20 Getting block 24 of 206 Getting block 25 of 206 Getting block 26 of 206 Calculating Z arrays for bucket 2 Entering block accumulator loop for bucket 1: Calculating Z arrays for bucket 3 Calculating Z arrays for bucket 4 Reserving size (4425267) for bucket 21 Calculating Z arrays for bucket 5 Reserving size (4425267) for bucket 22 Calculating Z arrays for bucket 6 Calculating Z arrays for bucket 7 Calculating Z arrays for bucket 8 Reserving size (4425267) for bucket 23 Calculating Z arrays for bucket 9 Calculating Z arrays for bucket 10 Calculating Z arrays for bucket 11 Calculating Z arrays for bucket 12 Calculating Z arrays for bucket 13 Calculating Z arrays for bucket 14 Calculating Z arrays for bucket 15 Calculating Z arrays for bucket 16 Calculating Z arrays for bucket 17 Calculating Z arrays for bucket 18 Calculating Z arrays for bucket 19 Calculating Z arrays for bucket 20 Reserving size (4425267) for bucket 24 Reserving size (4425267) for bucket 25 Reserving size (4425267) for bucket 26 Entering block accumulator loop for bucket 2: Entering block accumulator loop for bucket 4: Calculating Z arrays for bucket 21 Entering block accumulator loop for bucket 3: Calculating Z arrays for bucket 22 Entering block accumulator loop for bucket 5: Entering block accumulator loop for bucket 6: Entering block accumulator loop for bucket 7: Calculating Z arrays for bucket 23 Entering block accumulator loop for bucket 8: Entering block accumulator loop for bucket 9: Entering block accumulator loop for bucket 10: Entering block accumulator loop for bucket 11: Entering block accumulator loop for bucket 12: Entering block accumulator loop for bucket 13: Entering block accumulator loop for bucket 14: Entering block accumulator loop for bucket 15: Entering block accumulator loop for bucket 16: Entering block accumulator loop for bucket 17: Entering block accumulator loop for bucket 18: Entering block accumulator loop for bucket 19: Entering block accumulator loop for bucket 20: Calculating Z arrays for bucket 24 Calculating Z arrays for bucket 25 Calculating Z arrays for bucket 26 Entering block accumulator loop for bucket 21: Entering block accumulator loop for bucket 22: Entering block accumulator loop for bucket 23: Entering block accumulator loop for bucket 24: Entering block accumulator loop for bucket 25: Entering block accumulator loop for bucket 26: Getting block 27 of 206 Reserving size (4425267) for bucket 27 Calculating Z arrays for bucket 27 Entering block accumulator loop for bucket 27: bucket 4: 10% bucket 1: 10% bucket 3: 10% bucket 2: 10% bucket 24: 10% bucket 7: 10% bucket 5: 10% bucket 9: 10% bucket 13: 10% bucket 11: 10% bucket 6: 10% bucket 10: 10% bucket 21: 10% bucket 14: 10% bucket 8: 10% bucket 15: 10% bucket 12: 10% bucket 17: 10% bucket 16: 10% bucket 20: 10% bucket 22: 10% bucket 18: 10% bucket 25: 10% bucket 27: 10% bucket 19: 10% bucket 26: 10% bucket 23: 10% bucket 1: 20% bucket 4: 20% bucket 2: 20% bucket 3: 20% bucket 5: 20% bucket 7: 20% bucket 11: 20% bucket 9: 20% bucket 6: 20% bucket 13: 20% bucket 10: 20% bucket 8: 20% bucket 14: 20% bucket 24: 20% bucket 12: 20% bucket 15: 20% bucket 21: 20% bucket 16: 20% bucket 17: 20% bucket 20: 20% bucket 22: 20% bucket 18: 20% bucket 25: 20% bucket 27: 20% bucket 19: 20% bucket 26: 20% bucket 23: 20% bucket 1: 30% bucket 2: 30% bucket 3: 30% bucket 4: 30% bucket 5: 30% bucket 7: 30% bucket 11: 30% bucket 6: 30% bucket 9: 30% bucket 13: 30% bucket 8: 30% bucket 10: 30% bucket 12: 30% bucket 14: 30% bucket 15: 30% bucket 21: 30% bucket 16: 30% bucket 24: 30% bucket 17: 30% bucket 20: 30% bucket 22: 30% bucket 18: 30% bucket 25: 30% bucket 27: 30% bucket 19: 30% bucket 23: 30% bucket 26: 30% bucket 1: 40% bucket 2: 40% bucket 3: 40% bucket 4: 40% bucket 5: 40% bucket 7: 40% bucket 11: 40% bucket 6: 40% bucket 9: 40% bucket 13: 40% bucket 8: 40% bucket 10: 40% bucket 12: 40% bucket 14: 40% bucket 15: 40% bucket 16: 40% bucket 21: 40% bucket 17: 40% bucket 24: 40% bucket 20: 40% bucket 22: 40% bucket 1: 50% bucket 18: 40% bucket 27: 40% bucket 25: 40% bucket 2: 50% bucket 3: 50% bucket 23: 40% bucket 19: 40% bucket 26: 40% bucket 4: 50% bucket 5: 50% bucket 11: 50% bucket 6: 50% bucket 7: 50% bucket 9: 50% bucket 8: 50% bucket 13: 50% bucket 10: 50% bucket 12: 50% bucket 14: 50% bucket 15: 50% bucket 16: 50% bucket 1: 60% bucket 21: 50% bucket 17: 50% bucket 24: 50% bucket 2: 60% bucket 20: 50% bucket 22: 50% bucket 3: 60% bucket 18: 50% bucket 4: 60% bucket 27: 50% bucket 25: 50% bucket 23: 50% bucket 19: 50% bucket 5: 60% bucket 26: 50% bucket 11: 60% bucket 6: 60% bucket 7: 60% bucket 9: 60% bucket 8: 60% bucket 13: 60% bucket 1: 70% bucket 10: 60% bucket 12: 60% bucket 14: 60% bucket 15: 60% bucket 16: 60% bucket 2: 70% bucket 21: 60% bucket 3: 70% bucket 17: 60% bucket 24: 60% bucket 20: 60% bucket 22: 60% bucket 4: 70% bucket 18: 60% bucket 5: 70% bucket 27: 60% bucket 25: 60% bucket 23: 60% bucket 19: 60% bucket 11: 70% bucket 6: 70% bucket 26: 60% bucket 7: 70% bucket 9: 70% bucket 1: 80% bucket 8: 70% bucket 13: 70% bucket 12: 70% bucket 10: 70% bucket 14: 70% bucket 2: 80% bucket 15: 70% bucket 3: 80% bucket 16: 70% bucket 21: 70% bucket 17: 70% bucket 4: 80% bucket 24: 70% bucket 5: 80% bucket 20: 70% bucket 22: 70% bucket 18: 70% bucket 27: 70% bucket 23: 70% bucket 25: 70% bucket 11: 80% bucket 1: 90% bucket 6: 80% bucket 7: 80% bucket 19: 70% bucket 9: 80% bucket 26: 70% bucket 8: 80% bucket 2: 90% bucket 13: 80% bucket 3: 90% bucket 12: 80% bucket 10: 80% bucket 14: 80% bucket 15: 80% bucket 16: 80% bucket 4: 90% bucket 21: 80% bucket 17: 80% bucket 5: 90% bucket 24: 80% bucket 20: 80% bucket 22: 80% bucket 1: 100% Sorting block of length 2789167 for bucket 1 (Using difference cover) bucket 18: 80% bucket 11: 90% bucket 6: 90% bucket 7: 90% bucket 23: 80% bucket 27: 80% bucket 25: 80% bucket 9: 90% bucket 2: 100% Sorting block of length 2727143 for bucket 2 (Using difference cover) bucket 19: 80% bucket 8: 90% bucket 3: 100% Sorting block of length 3080850 for bucket 3 (Using difference cover) bucket 13: 90% bucket 26: 80% bucket 12: 90% bucket 10: 90% bucket 14: 90% bucket 15: 90% bucket 4: 100% Sorting block of length 2507499 for bucket 4 (Using difference cover) bucket 16: 90% bucket 5: 100% Sorting block of length 3952885 for bucket 5 (Using difference cover) bucket 17: 90% bucket 21: 90% bucket 24: 90% bucket 22: 90% bucket 20: 90% bucket 11: 100% Sorting block of length 1970908 for bucket 11 (Using difference cover) bucket 6: 100% Sorting block of length 4240275 for bucket 6 (Using difference cover) bucket 18: 90% bucket 7: 100% Sorting block of length 3290218 for bucket 7 (Using difference cover) bucket 9: 100% Sorting block of length 3907415 for bucket 9 (Using difference cover) bucket 23: 90% bucket 27: 90% bucket 8: 100% Sorting block of length 3249527 for bucket 8 (Using difference cover) bucket 25: 90% bucket 13: 100% Sorting block of length 3907486 for bucket 13 (Using difference cover) bucket 19: 90% bucket 12: 100% Sorting block of length 2781704 for bucket 12 (Using difference cover) bucket 10: 100% Sorting block of length 3888605 for bucket 10 (Using difference cover) bucket 14: 100% Sorting block of length 1469036 for bucket 14 (Using difference cover) bucket 26: 90% Sorting block time: 00:00:01 Returning block of 2789168 for bucket 1 bucket 15: 100% Sorting block of length 3353205 for bucket 15 (Using difference cover) bucket 16: 100% Sorting block of length 1928180 for bucket 16 (Using difference cover) Getting block 28 of 206 Reserving size (4425267) for bucket 28 Calculating Z arrays for bucket 28 Entering block accumulator loop for bucket 28: bucket 17: 100% Sorting block of length 3224352 for bucket 17 (Using difference cover) bucket 21: 100% Sorting block of length 4317424 for bucket 21 (Using difference cover) bucket 24: 100% Sorting block of length 1051951 for bucket 24 (Using difference cover) bucket 22: 100% Sorting block of length 3299135 for bucket 22 (Using difference cover) bucket 20: 100% Sorting block of length 4231638 for bucket 20 (Using difference cover) bucket 18: 100% Sorting block of length 2967929 for bucket 18 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2727144 for bucket 2 bucket 23: 100% Sorting block of length 3934660 for bucket 23 (Using difference cover) bucket 27: 100% Sorting block of length 1267742 for bucket 27 (Using difference cover) Getting block 29 of 206 Reserving size (4425267) for bucket 29 Calculating Z arrays for bucket 29 Entering block accumulator loop for bucket 29: bucket 25: 100% Sorting block of length 3880955 for bucket 25 (Using difference cover) Sorting block time: 00:00:00 Returning block of 1970909 for bucket 11 bucket 19: 100% Sorting block of length 2945076 for bucket 19 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2507500 for bucket 4 Getting block 30 of 206 Reserving size (4425267) for bucket 30 Calculating Z arrays for bucket 30 Entering block accumulator loop for bucket 30: bucket 26: 100% Sorting block of length 3225110 for bucket 26 (Using difference cover) Getting block 31 of 206 Reserving size (4425267) for bucket 31 Calculating Z arrays for bucket 31 Entering block accumulator loop for bucket 31: Sorting block time: 00:00:02 Returning block of 3080851 for bucket 3 bucket 28: 10% Sorting block time: 00:00:01 Returning block of 1469037 for bucket 14 Getting block 32 of 206 Reserving size (4425267) for bucket 32 Calculating Z arrays for bucket 32 Entering block accumulator loop for bucket 32: Getting block 33 of 206 Reserving size (4425267) for bucket 33 Calculating Z arrays for bucket 33 Entering block accumulator loop for bucket 33: Sorting block time: 00:00:01 Returning block of 1051952 for bucket 24 Getting block 34 of 206 Reserving size (4425267) for bucket 34 Calculating Z arrays for bucket 34 Entering block accumulator loop for bucket 34: Sorting block time: 00:00:01 Returning block of 1928181 for bucket 16 Sorting block time: 00:00:01 Returning block of 1267743 for bucket 27 Getting block 35 of 206 Reserving size (4425267) for bucket 35 Calculating Z arrays for bucket 35 Entering block accumulator loop for bucket 35: Getting block 36 of 206 Reserving size (4425267) for bucket 36 Calculating Z arrays for bucket 36 Entering block accumulator loop for bucket 36: Sorting block time: 00:00:01 Returning block of 2781705 for bucket 12 bucket 29: 10% Sorting block time: 00:00:01 Returning block of 3290219 for bucket 7 Getting block 37 of 206 Reserving size (4425267) for bucket 37 Calculating Z arrays for bucket 37 Entering block accumulator loop for bucket 37: bucket 30: 10% Getting block 38 of 206 Reserving size (4425267) for bucket 38 Calculating Z arrays for bucket 38 Entering block accumulator loop for bucket 38: Sorting block time: 00:00:01 Returning block of 3249528 for bucket 8 Sorting block time: 00:00:02 Returning block of 3952886 for bucket 5 bucket 31: 10% Getting block 39 of 206 Reserving size (4425267) for bucket 39 Calculating Z arrays for bucket 39 Entering block accumulator loop for bucket 39: bucket 28: 20% Getting block 40 of 206 Reserving size (4425267) for bucket 40 Calculating Z arrays for bucket 40 Entering block accumulator loop for bucket 40: bucket 33: 10% bucket 32: 10% Sorting block time: 00:00:02 Returning block of 3907416 for bucket 9 bucket 34: 10% Getting block 41 of 206 Reserving size (4425267) for bucket 41 Calculating Z arrays for bucket 41 Entering block accumulator loop for bucket 41: Sorting block time: 00:00:02 Returning block of 3299136 for bucket 22 Sorting block time: 00:00:02 Returning block of 3353206 for bucket 15 bucket 36: 10% bucket 35: 10% Getting block 42 of 206 Reserving size (4425267) for bucket 42 Calculating Z arrays for bucket 42 Entering block accumulator loop for bucket 42: Sorting block time: 00:00:02 Returning block of 3224353 for bucket 17 bucket 29: 20% Sorting block time: 00:00:02 Returning block of 4240276 for bucket 6 Getting block 43 of 206 Reserving size (4425267) for bucket 43 Calculating Z arrays for bucket 43 Entering block accumulator loop for bucket 43: Sorting block time: 00:00:02 Returning block of 3888606 for bucket 10 Sorting block time: 00:00:02 Returning block of 3907487 for bucket 13 Sorting block time: 00:00:01 Returning block of 2945077 for bucket 19 Sorting block time: 00:00:01 Returning block of 3225111 for bucket 26 Getting block 44 of 206 Reserving size (4425267) for bucket 44 Calculating Z arrays for bucket 44 Entering block accumulator loop for bucket 44: bucket 37: 10% Sorting block time: 00:00:02 Returning block of 2967930 for bucket 18 Getting block 45 of 206 Reserving size (4425267) for bucket 45 Calculating Z arrays for bucket 45 Entering block accumulator loop for bucket 45: Getting block 46 of 206 Reserving size (4425267) for bucket 46 Calculating Z arrays for bucket 46 Entering block accumulator loop for bucket 46: Getting block 47 of 206 Reserving size (4425267) for bucket 47 Calculating Z arrays for bucket 47 Entering block accumulator loop for bucket 47: Getting block 48 of 206 Reserving size (4425267) for bucket 48 Calculating Z arrays for bucket 48 Entering block accumulator loop for bucket 48: bucket 38: 10% Getting block 49 of 206 Reserving size (4425267) for bucket 49 Calculating Z arrays for bucket 49 Entering block accumulator loop for bucket 49: bucket 30: 20% Getting block 50 of 206 Reserving size (4425267) for bucket 50 Calculating Z arrays for bucket 50 Entering block accumulator loop for bucket 50: Sorting block time: 00:00:02 Returning block of 3880956 for bucket 25 bucket 31: 20% bucket 39: 10% bucket 28: 30% bucket 40: 10% Getting block 51 of 206 Reserving size (4425267) for bucket 51 Calculating Z arrays for bucket 51 Entering block accumulator loop for bucket 51: Sorting block time: 00:00:02 Returning block of 4231639 for bucket 20 bucket 32: 20% Sorting block time: 00:00:02 Returning block of 3934661 for bucket 23 bucket 33: 20% Getting block 52 of 206 Reserving size (4425267) for bucket 52 Calculating Z arrays for bucket 52 Entering block accumulator loop for bucket 52: bucket 34: 20% Getting block 53 of 206 Reserving size (4425267) for bucket 53 Calculating Z arrays for bucket 53 Entering block accumulator loop for bucket 53: bucket 41: 10% bucket 36: 20% bucket 42: 10% bucket 29: 30% bucket 35: 20% bucket 43: 10% bucket 37: 20% bucket 38: 20% bucket 45: 10% bucket 44: 10% bucket 46: 10% bucket 48: 10% bucket 30: 30% bucket 47: 10% bucket 39: 20% bucket 28: 40% bucket 50: 10% Sorting block time: 00:00:03 Returning block of 4317425 for bucket 21 bucket 40: 20% bucket 32: 30% bucket 31: 30% bucket 51: 10% Getting block 54 of 206 Reserving size (4425267) for bucket 54 Calculating Z arrays for bucket 54 Entering block accumulator loop for bucket 54: bucket 33: 30% bucket 34: 30% bucket 41: 20% bucket 49: 10% bucket 53: 10% bucket 52: 10% bucket 36: 30% bucket 42: 20% bucket 43: 20% bucket 38: 30% bucket 29: 40% bucket 35: 30% bucket 30: 40% bucket 45: 20% bucket 48: 20% bucket 44: 20% bucket 46: 20% bucket 39: 30% bucket 37: 30% bucket 28: 50% bucket 40: 30% bucket 47: 20% bucket 50: 20% bucket 31: 40% bucket 51: 20% bucket 33: 40% bucket 32: 40% bucket 34: 40% bucket 54: 10% bucket 41: 30% bucket 36: 40% bucket 53: 20% bucket 52: 20% bucket 49: 20% bucket 43: 30% bucket 42: 30% bucket 38: 40% bucket 45: 30% bucket 39: 40% bucket 28: 60% bucket 29: 50% bucket 48: 30% bucket 44: 30% bucket 30: 50% bucket 40: 40% bucket 35: 40% bucket 46: 30% bucket 37: 40% bucket 47: 30% bucket 31: 50% bucket 33: 50% bucket 32: 50% bucket 34: 50% bucket 51: 30% bucket 41: 40% bucket 54: 20% bucket 36: 50% bucket 50: 30% bucket 53: 30% bucket 43: 40% bucket 42: 40% bucket 38: 50% bucket 52: 30% bucket 49: 30% bucket 39: 50% bucket 45: 40% bucket 28: 70% bucket 40: 50% bucket 48: 40% bucket 29: 60% bucket 30: 60% bucket 44: 40% bucket 35: 50% bucket 46: 40% bucket 33: 60% bucket 47: 40% bucket 32: 60% bucket 31: 60% bucket 34: 60% bucket 41: 50% bucket 51: 40% bucket 36: 60% bucket 37: 50% bucket 54: 30% bucket 50: 40% bucket 43: 50% bucket 38: 60% bucket 53: 40% bucket 42: 50% bucket 39: 60% bucket 52: 40% bucket 49: 40% bucket 28: 80% bucket 45: 50% bucket 40: 60% bucket 48: 50% bucket 29: 70% bucket 35: 60% bucket 44: 50% bucket 46: 50% bucket 33: 70% bucket 31: 70% bucket 32: 70% bucket 34: 70% bucket 41: 60% bucket 47: 50% bucket 36: 70% bucket 51: 50% bucket 30: 70% bucket 37: 60% bucket 38: 70% bucket 43: 60% bucket 54: 40% bucket 42: 60% bucket 53: 50% bucket 50: 50% Exited Ebwt loop fchr[A]: 0 fchr[C]: 330645804 fchr[G]: 463945382 fchr[T]: 463945382 fchr[$]: 660839850 Exiting Ebwt::buildToDisk() Returning from initFromVector Wrote 224523443 bytes to primary EBWT file: BS_GA.1.bt2 Wrote 165209968 bytes to secondary EBWT file: BS_GA.2.bt2 Re-opening _in1 and _in2 as input streams Returning from Ebwt constructor Headers: len: 660839850 bwtLen: 660839851 sz: 165209963 bwtSz: 165209963 lineRate: 6 offRate: 4 offMask: 0xfffffff0 ftabChars: 10 eftabLen: 20 eftabSz: 80 ftabLen: 1048577 ftabSz: 4194308 offsLen: 41302491 offsSz: 165209964 lineSz: 64 sideSz: 64 sideBwtSz: 48 sideBwtLen: 192 numSides: 3441875 numLines: 3441875 ebwtTotLen: 220280000 ebwtTotSz: 220280000 color: 0 reverse: 0 bucket 39: 70% Total time for call to driver() for forward index: 00:04:22 Reading reference sizes bucket 28: 90% bucket 40: 70% bucket 45: 60% bucket 49: 50% bucket 52: 50% bucket 48: 60% bucket 29: 80% bucket 46: 60% bucket 44: 60% bucket 35: 70% bucket 33: 80% bucket 32: 80% bucket 41: 70% bucket 34: 80% bucket 36: 80% bucket 30: 80% bucket 47: 60% bucket 51: 60% bucket 38: 80% bucket 43: 70% bucket 37: 70% bucket 31: 80% bucket 54: 50% bucket 42: 70% bucket 53: 60% bucket 39: 80% bucket 40: 80% bucket 28: 100% Sorting block of length 4119509 for bucket 28 (Using difference cover) bucket 50: 60% bucket 45: 70% bucket 29: 90% bucket 48: 70% bucket 52: 60% bucket 46: 70% bucket 33: 90% bucket 44: 70% bucket 41: 80% bucket 32: 90% bucket 34: 90% bucket 36: 90% bucket 49: 60% bucket 38: 90% bucket 30: 90% bucket 43: 80% bucket 51: 70% bucket 47: 70% bucket 35: 80% bucket 31: 90% bucket 37: 80% bucket 42: 80% bucket 54: 60% bucket 39: 90% bucket 40: 90% bucket 53: 70% bucket 45: 80% bucket 29: 100% Sorting block of length 3405267 for bucket 29 (Using difference cover) bucket 50: 70% bucket 48: 80% bucket 46: 80% bucket 33: 100% Sorting block of length 3212285 for bucket 33 (Using difference cover) bucket 41: 90% bucket 34: 100% Sorting block of length 1608834 for bucket 34 (Using difference cover) bucket 36: 100% Sorting block of length 3848076 for bucket 36 (Using difference cover) bucket 44: 80% bucket 32: 100% Sorting block of length 3275810 for bucket 32 (Using difference cover) bucket 38: 100% Sorting block of length 3330900 for bucket 38 (Using difference cover) bucket 52: 70% bucket 43: 90% bucket 49: 70% bucket 30: 100% Sorting block of length 4250134 for bucket 30 (Using difference cover) bucket 51: 80% bucket 35: 90% bucket 37: 90% bucket 42: 90% bucket 47: 80% bucket 39: 100% Sorting block of length 3126993 for bucket 39 (Using difference cover) bucket 31: 100% Sorting block of length 4342797 for bucket 31 (Using difference cover) bucket 40: 100% Sorting block of length 4401704 for bucket 40 (Using difference cover) bucket 54: 70% bucket 53: 80% bucket 45: 90% bucket 48: 90% bucket 50: 80% bucket 41: 100% Sorting block of length 3236176 for bucket 41 (Using difference cover) Sorting block time: 00:00:00 Returning block of 1608835 for bucket 34 bucket 46: 90% Getting block 55 of 206 Reserving size (4425267) for bucket 55 Calculating Z arrays for bucket 55 Entering block accumulator loop for bucket 55: bucket 44: 90% Sorting block time: 00:00:01 Returning block of 4119510 for bucket 28 bucket 43: 100% Sorting block of length 126944 for bucket 43 (Using difference cover) Sorting block time: 00:00:00 Returning block of 126945 for bucket 43 Getting block 56 of 206 Reserving size (4425267) for bucket 56 Calculating Z arrays for bucket 56 Entering block accumulator loop for bucket 56: Getting block 57 of 206 Reserving size (4425267) for bucket 57 Calculating Z arrays for bucket 57 Entering block accumulator loop for bucket 57: bucket 35: 100% Sorting block of length 2977350 for bucket 35 (Using difference cover) bucket 37: 100% Sorting block of length 3918998 for bucket 37 (Using difference cover) bucket 52: 80% bucket 49: 80% bucket 51: 90% bucket 42: 100% Sorting block of length 4347361 for bucket 42 (Using difference cover) bucket 47: 90% bucket 54: 80% bucket 53: 90% bucket 45: 100% Sorting block of length 575352 for bucket 45 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3405268 for bucket 29 bucket 48: 100% Sorting block of length 628984 for bucket 48 (Using difference cover) bucket 50: 90% bucket 46: 100% Sorting block of length 3150266 for bucket 46 (Using difference cover) Getting block 58 of 206 Reserving size (4425267) for bucket 58 Calculating Z arrays for bucket 58 Entering block accumulator loop for bucket 58: Sorting block time: 00:00:00 Returning block of 575353 for bucket 45 Getting block 59 of 206 Reserving size (4425267) for bucket 59 Calculating Z arrays for bucket 59 Entering block accumulator loop for bucket 59: Sorting block time: 00:00:01 Returning block of 3212286 for bucket 33 bucket 44: 100% Sorting block of length 5911212 for bucket 44 (Using difference cover) Sorting block time: 00:00:00 Returning block of 628985 for bucket 48 Getting block 60 of 206 Reserving size (4425267) for bucket 60 Calculating Z arrays for bucket 60 Entering block accumulator loop for bucket 60: Getting block 61 of 206 Reserving size (4425267) for bucket 61 Calculating Z arrays for bucket 61 Entering block accumulator loop for bucket 61: bucket 56: 10% bucket 57: 10% bucket 49: 90% Sorting block time: 00:00:01 Returning block of 3275811 for bucket 32 Sorting block time: 00:00:01 Returning block of 3848077 for bucket 36 bucket 55: 10% bucket 52: 90% bucket 47: 100% Sorting block of length 3800872 for bucket 47 (Using difference cover) Getting block 62 of 206 Reserving size (4425267) for bucket 62 Calculating Z arrays for bucket 62 Entering block accumulator loop for bucket 62: Sorting block time: 00:00:01 Returning block of 3330901 for bucket 38 Getting block 63 of 206 Reserving size (4425267) for bucket 63 Calculating Z arrays for bucket 63 Entering block accumulator loop for bucket 63: Getting block 64 of 206 Reserving size (4425267) for bucket 64 Calculating Z arrays for bucket 64 Entering block accumulator loop for bucket 64: bucket 51: 100% Sorting block of length 2319185 for bucket 51 (Using difference cover) bucket 54: 90% bucket 53: 100% Sorting block of length 2116489 for bucket 53 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4250135 for bucket 30 Getting block 65 of 206 Reserving size (4425267) for bucket 65 Calculating Z arrays for bucket 65 Entering block accumulator loop for bucket 65: bucket 50: 100% Sorting block of length 2819914 for bucket 50 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3236177 for bucket 41 bucket 59: 10% Sorting block time: 00:00:02 Returning block of 4342798 for bucket 31 Getting block 66 of 206 Reserving size (4425267) for bucket 66 Calculating Z arrays for bucket 66 Entering block accumulator loop for bucket 66: bucket 58: 10% bucket 61: 10% Getting block 67 of 206 Reserving size (4425267) for bucket 67 Calculating Z arrays for bucket 67 Entering block accumulator loop for bucket 67: bucket 56: 20% bucket 60: 10% bucket 57: 20% bucket 49: 100% Sorting block of length 3806191 for bucket 49 (Using difference cover) bucket 52: 100% Sorting block of length 2703587 for bucket 52 (Using difference cover) bucket 55: 20% Sorting block time: 00:00:01 Returning block of 2977351 for bucket 35 bucket 64: 10% bucket 62: 10% Sorting block time: 00:00:01 Returning block of 3918999 for bucket 37 bucket 63: 10% bucket 54: 100% Sorting block of length 4221138 for bucket 54 (Using difference cover) Getting block 68 of 206 Reserving size (4425267) for bucket 68 Calculating Z arrays for bucket 68 Entering block accumulator loop for bucket 68: Getting block 69 of 206 Reserving size (4425267) for bucket 69 Calculating Z arrays for bucket 69 Entering block accumulator loop for bucket 69: bucket 65: 10% Sorting block time: 00:00:01 Returning block of 3150267 for bucket 46 bucket 66: 10% Sorting block time: 00:00:03 Returning block of 4401705 for bucket 40 Sorting block time: 00:00:02 Returning block of 4347362 for bucket 42 Getting block 70 of 206 Reserving size (4425267) for bucket 70 Calculating Z arrays for bucket 70 Entering block accumulator loop for bucket 70: bucket 59: 20% Sorting block time: 00:00:03 Returning block of 3126994 for bucket 39 Getting block 71 of 206 Reserving size (4425267) for bucket 71 Calculating Z arrays for bucket 71 Entering block accumulator loop for bucket 71: bucket 58: 20% bucket 67: 10% Sorting block time: 00:00:02 Returning block of 2319186 for bucket 51 Getting block 72 of 206 Reserving size (4425267) for bucket 72 Calculating Z arrays for bucket 72 Entering block accumulator loop for bucket 72: Sorting block time: 00:00:02 Returning block of 2116490 for bucket 53 Getting block 73 of 206 Reserving size (4425267) for bucket 73 Calculating Z arrays for bucket 73 Entering block accumulator loop for bucket 73: Getting block 74 of 206 Reserving size (4425267) for bucket 74 Calculating Z arrays for bucket 74 Entering block accumulator loop for bucket 74: Getting block 75 of 206 Reserving size (4425267) for bucket 75 Calculating Z arrays for bucket 75 Entering block accumulator loop for bucket 75: bucket 56: 30% bucket 61: 20% bucket 57: 30% bucket 60: 20% bucket 64: 20% bucket 55: 30% bucket 68: 10% Sorting block time: 00:00:02 Returning block of 3800873 for bucket 47 bucket 63: 20% bucket 62: 20% Time reading reference sizes: 00:00:05 Calculating joined length Writing header Reserving space for joined string Joining reference sequences bucket 69: 10% Getting block 76 of 206 Reserving size (4425267) for bucket 76 Calculating Z arrays for bucket 76 Entering block accumulator loop for bucket 76: bucket 65: 20% Sorting block time: 00:00:01 Returning block of 2819915 for bucket 50 bucket 66: 20% Getting block 77 of 206 Reserving size (4425267) for bucket 77 Calculating Z arrays for bucket 77 Entering block accumulator loop for bucket 77: bucket 70: 10% bucket 71: 10% bucket 67: 20% bucket 59: 30% bucket 72: 10% Sorting block time: 00:00:01 Returning block of 2703588 for bucket 52 bucket 58: 30% bucket 73: 10% bucket 74: 10% bucket 75: 10% Getting block 78 of 206 Reserving size (4425267) for bucket 78 Calculating Z arrays for bucket 78 Entering block accumulator loop for bucket 78: bucket 61: 30% bucket 64: 30% bucket 68: 20% bucket 56: 40% bucket 55: 40% bucket 69: 20% Sorting block time: 00:00:02 Returning block of 3806192 for bucket 49 bucket 57: 40% bucket 63: 30% bucket 76: 10% bucket 60: 30% bucket 65: 30% bucket 62: 30% Sorting block time: 00:00:03 Returning block of 5911213 for bucket 44 Getting block 79 of 206 Reserving size (4425267) for bucket 79 Calculating Z arrays for bucket 79 Entering block accumulator loop for bucket 79: bucket 66: 30% bucket 70: 20% bucket 71: 20% Getting block 80 of 206 Reserving size (4425267) for bucket 80 Calculating Z arrays for bucket 80 Entering block accumulator loop for bucket 80: bucket 67: 30% bucket 72: 20% bucket 77: 10% bucket 74: 20% bucket 73: 20% bucket 58: 40% bucket 78: 10% bucket 75: 20% Sorting block time: 00:00:02 Returning block of 4221139 for bucket 54 bucket 64: 40% bucket 59: 40% bucket 68: 30% Getting block 81 of 206 Reserving size (4425267) for bucket 81 Calculating Z arrays for bucket 81 Entering block accumulator loop for bucket 81: bucket 61: 40% bucket 56: 50% bucket 69: 30% bucket 55: 50% bucket 65: 40% bucket 76: 20% bucket 79: 10% bucket 63: 40% bucket 57: 50% bucket 62: 40% bucket 70: 30% bucket 60: 40% bucket 66: 40% bucket 71: 30% bucket 67: 40% bucket 80: 10% bucket 74: 30% bucket 73: 30% bucket 64: 50% bucket 72: 30% bucket 77: 20% bucket 75: 30% bucket 68: 40% bucket 78: 20% bucket 58: 50% bucket 69: 40% bucket 81: 10% bucket 59: 50% bucket 61: 50% bucket 56: 60% bucket 65: 50% bucket 76: 30% bucket 55: 60% bucket 70: 40% bucket 63: 50% bucket 79: 20% bucket 71: 40% bucket 66: 50% bucket 57: 60% bucket 62: 50% bucket 60: 50% bucket 67: 50% bucket 64: 60% bucket 74: 40% bucket 72: 40% bucket 68: 50% bucket 75: 40% bucket 80: 20% bucket 77: 30% bucket 73: 40% bucket 81: 20% bucket 78: 30% bucket 69: 50% bucket 58: 60% bucket 59: 60% bucket 56: 70% bucket 61: 60% bucket 65: 60% bucket 76: 40% bucket 70: 50% bucket 71: 50% bucket 66: 60% bucket 55: 70% bucket 63: 60% bucket 57: 70% bucket 67: 60% bucket 79: 30% bucket 62: 60% bucket 60: 60% bucket 64: 70% bucket 74: 50% bucket 72: 50% bucket 68: 60% bucket 80: 30% bucket 75: 50% bucket 77: 40% bucket 81: 30% bucket 69: 60% bucket 73: 50% Time to join reference sequences: 00:00:03 Time to reverse reference sequence: 00:00:01 bmax according to bmaxDivN setting: 5900355 Using parameters --bmax 4425267 --dcv 1024 Doing ahead-of-time memory usage test bucket 78: 40% bucket 58: 70% bucket 65: 70% bucket 59: 70% bucket 56: 80% bucket 70: 60% bucket 76: 50% bucket 61: 70% bucket 71: 60% bucket 66: 70% bucket 67: 70% bucket 79: 40% bucket 55: 80% bucket 63: 70% bucket 57: 80% bucket 64: 80% bucket 68: 70% bucket 74: 60% bucket 62: 70% bucket 72: 60% bucket 60: 70% bucket 80: 40% bucket 69: 70% bucket 75: 60% bucket 81: 40% bucket 77: 50% bucket 73: 60% bucket 78: 50% Passed! Constructing with these parameters: --bmax 4425267 --dcv 1024 Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime bucket 70: 70% bucket 58: 80% bucket 65: 80% bucket 71: 70% bucket 56: 90% bucket 76: 60% bucket 66: 80% bucket 59: 80% bucket 61: 80% bucket 67: 80% Building sPrimeOrder V-Sorting samples bucket 64: 90% bucket 57: 90% bucket 63: 80% bucket 55: 90% bucket 79: 50% bucket 74: 70% bucket 68: 80% bucket 72: 70% bucket 80: 50% bucket 69: 80% bucket 81: 50% bucket 75: 70% bucket 60: 80% bucket 62: 80% bucket 77: 60% bucket 73: 70% bucket 78: 60% bucket 71: 80% bucket 65: 90% bucket 66: 90% bucket 76: 70% bucket 70: 80% bucket 58: 90% bucket 56: 100% Sorting block of length 4067919 for bucket 56 (Using difference cover) bucket 67: 90% bucket 59: 90% bucket 61: 90% bucket 64: 100% Sorting block of length 4246235 for bucket 64 (Using difference cover) bucket 68: 90% bucket 69: 90% bucket 79: 60% bucket 57: 100% Sorting block of length 2840266 for bucket 57 (Using difference cover) bucket 72: 80% bucket 63: 90% bucket 81: 60% bucket 74: 80% bucket 75: 80% bucket 55: 100% Sorting block of length 4069938 for bucket 55 (Using difference cover) bucket 80: 60% bucket 73: 80% bucket 77: 70% bucket 60: 90% bucket 62: 90% bucket 78: 70% bucket 71: 90% bucket 66: 100% Sorting block of length 3000158 for bucket 66 (Using difference cover) bucket 70: 90% bucket 76: 80% bucket 67: 100% Sorting block of length 2672868 for bucket 67 (Using difference cover) bucket 65: 100% Sorting block of length 1831230 for bucket 65 (Using difference cover) bucket 58: 100% Sorting block of length 3969044 for bucket 58 (Using difference cover) bucket 59: 100% Sorting block of length 3665041 for bucket 59 (Using difference cover) bucket 61: 100% Sorting block of length 3718709 for bucket 61 (Using difference cover) bucket 69: 100% Sorting block of length 207327 for bucket 69 (Using difference cover) bucket 79: 70% bucket 81: 70% bucket 72: 90% bucket 68: 100% Sorting block of length 6340840 for bucket 68 (Using difference cover) Sorting block time: 00:00:00 Returning block of 207328 for bucket 69 Getting block 82 of 206 Reserving size (4425267) for bucket 82 Calculating Z arrays for bucket 82 Entering block accumulator loop for bucket 82: bucket 63: 100% Sorting block of length 2643099 for bucket 63 (Using difference cover) bucket 75: 90% bucket 74: 90% bucket 80: 70% bucket 73: 90% bucket 77: 80% bucket 78: 80% bucket 60: 100% Sorting block of length 1860597 for bucket 60 (Using difference cover) bucket 62: 100% Sorting block of length 3229913 for bucket 62 (Using difference cover) bucket 71: 100% Sorting block of length 4297834 for bucket 71 (Using difference cover) bucket 70: 100% Sorting block of length 1434648 for bucket 70 (Using difference cover) bucket 76: 90% Sorting block time: 00:00:01 Returning block of 1831231 for bucket 65 Getting block 83 of 206 Reserving size (4425267) for bucket 83 Calculating Z arrays for bucket 83 Entering block accumulator loop for bucket 83: bucket 79: 80% bucket 81: 80% bucket 72: 100% Sorting block of length 3574217 for bucket 72 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2840267 for bucket 57 bucket 82: 10% Sorting block time: 00:00:01 Returning block of 2672869 for bucket 67 Getting block 84 of 206 Reserving size (4425267) for bucket 84 Calculating Z arrays for bucket 84 Entering block accumulator loop for bucket 84: bucket 74: 100% Sorting block of length 2599936 for bucket 74 (Using difference cover) bucket 75: 100% Sorting block of length 4001736 for bucket 75 (Using difference cover) bucket 80: 80% Getting block 85 of 206 Reserving size (4425267) for bucket 85 Calculating Z arrays for bucket 85 Entering block accumulator loop for bucket 85: Sorting block time: 00:00:02 Returning block of 4246236 for bucket 64 Sorting block time: 00:00:02 Returning block of 4067920 for bucket 56 bucket 73: 100% Sorting block of length 4072312 for bucket 73 (Using difference cover) Sorting block time: 00:00:01 Returning block of 3000159 for bucket 66 Sorting block time: 00:00:00 Returning block of 1434649 for bucket 70 bucket 77: 90% Getting block 86 of 206 Reserving size (4425267) for bucket 86 Calculating Z arrays for bucket 86 Entering block accumulator loop for bucket 86: Getting block 87 of 206 Reserving size (4425267) for bucket 87 Calculating Z arrays for bucket 87 Entering block accumulator loop for bucket 87: Getting block 88 of 206 Reserving size (4425267) for bucket 88 Calculating Z arrays for bucket 88 Entering block accumulator loop for bucket 88: Getting block 89 of 206 Reserving size (4425267) for bucket 89 Calculating Z arrays for bucket 89 Entering block accumulator loop for bucket 89: bucket 78: 90% bucket 76: 100% Sorting block of length 2509353 for bucket 76 (Using difference cover) bucket 83: 10% bucket 79: 90% Sorting block time: 00:00:01 Returning block of 1860598 for bucket 60 Getting block 90 of 206 Reserving size (4425267) for bucket 90 Calculating Z arrays for bucket 90 Entering block accumulator loop for bucket 90: bucket 81: 90% bucket 84: 10% bucket 82: 20% Sorting block time: 00:00:02 Returning block of 4069939 for bucket 55 Sorting block time: 00:00:02 Returning block of 2643100 for bucket 63 bucket 80: 90% bucket 85: 10% Getting block 91 of 206 Reserving size (4425267) for bucket 91 Calculating Z arrays for bucket 91 Entering block accumulator loop for bucket 91: Sorting block time: 00:00:02 Returning block of 3665042 for bucket 59 Getting block 92 of 206 Reserving size (4425267) for bucket 92 Calculating Z arrays for bucket 92 Entering block accumulator loop for bucket 92: Sorting block time: 00:00:02 Returning block of 3969045 for bucket 58 bucket 77: 100% Sorting block of length 2306176 for bucket 77 (Using difference cover) Getting block 93 of 206 Reserving size (4425267) for bucket 93 Calculating Z arrays for bucket 93 Entering block accumulator loop for bucket 93: bucket 86: 10% bucket 87: 10% bucket 78: 100% Sorting block of length 4254836 for bucket 78 (Using difference cover) bucket 88: 10% Getting block 94 of 206 Reserving size (4425267) for bucket 94 Calculating Z arrays for bucket 94 Entering block accumulator loop for bucket 94: bucket 89: 10% Sorting block time: 00:00:01 Returning block of 3229914 for bucket 62 Getting block 95 of 206 Reserving size (4425267) for bucket 95 Calculating Z arrays for bucket 95 Entering block accumulator loop for bucket 95: bucket 83: 20% bucket 79: 100% Sorting block of length 4129989 for bucket 79 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3718710 for bucket 61 Sorting block time: 00:00:01 Returning block of 4297835 for bucket 71 bucket 81: 100% Sorting block of length 4034267 for bucket 81 (Using difference cover) Getting block 96 of 206 Reserving size (4425267) for bucket 96 Calculating Z arrays for bucket 96 Entering block accumulator loop for bucket 96: Sorting block time: 00:00:01 Returning block of 2599937 for bucket 74 bucket 90: 10% Getting block 97 of 206 Reserving size (4425267) for bucket 97 Calculating Z arrays for bucket 97 Entering block accumulator loop for bucket 97: bucket 84: 20% Getting block 98 of 206 Reserving size (4425267) for bucket 98 Calculating Z arrays for bucket 98 Entering block accumulator loop for bucket 98: Sorting block time: 00:00:01 Returning block of 3574218 for bucket 72 bucket 82: 30% bucket 80: 100% Sorting block of length 2861726 for bucket 80 (Using difference cover) Getting block 99 of 206 Reserving size (4425267) for bucket 99 Calculating Z arrays for bucket 99 Entering block accumulator loop for bucket 99: bucket 85: 20% bucket 91: 10% bucket 92: 10% bucket 93: 10% Sorting block time: 00:00:02 Returning block of 2509354 for bucket 76 bucket 87: 20% bucket 86: 20% bucket 88: 20% bucket 94: 10% Getting block 100 of 206 Reserving size (4425267) for bucket 100 Calculating Z arrays for bucket 100 Entering block accumulator loop for bucket 100: bucket 89: 20% Sorting block time: 00:00:02 Returning block of 4001737 for bucket 75 bucket 83: 30% Sorting block time: 00:00:01 Returning block of 2306177 for bucket 77 Sorting block time: 00:00:02 Returning block of 4072313 for bucket 73 Getting block 101 of 206 Reserving size (4425267) for bucket 101 Calculating Z arrays for bucket 101 Entering block accumulator loop for bucket 101: bucket 95: 10% Getting block 102 of 206 Reserving size (4425267) for bucket 102 Calculating Z arrays for bucket 102 Entering block accumulator loop for bucket 102: Getting block 103 of 206 Reserving size (4425267) for bucket 103 Calculating Z arrays for bucket 103 Entering block accumulator loop for bucket 103: bucket 84: 30% bucket 96: 10% bucket 90: 20% bucket 82: 40% bucket 85: 30% bucket 98: 10% bucket 99: 10% bucket 91: 20% bucket 97: 10% Sorting block time: 00:00:04 Returning block of 6340841 for bucket 68 bucket 86: 30% bucket 93: 20% bucket 100: 10% bucket 87: 30% bucket 92: 20% bucket 89: 30% bucket 88: 30% Getting block 104 of 206 Reserving size (4425267) for bucket 104 Calculating Z arrays for bucket 104 Entering block accumulator loop for bucket 104: bucket 101: 10% bucket 83: 40% bucket 94: 20% bucket 82: 50% bucket 103: 10% Sorting block time: 00:00:01 Returning block of 2861727 for bucket 80 Sorting block time: 00:00:02 Returning block of 4129990 for bucket 79 Sorting block time: 00:00:02 Returning block of 4034268 for bucket 81 Getting block 105 of 206 Reserving size (4425267) for bucket 105 Calculating Z arrays for bucket 105 Entering block accumulator loop for bucket 105: bucket 85: 40% bucket 84: 40% bucket 98: 20% bucket 102: 10% Getting block 106 of 206 Reserving size (4425267) for bucket 106 Calculating Z arrays for bucket 106 Entering block accumulator loop for bucket 106: Sorting block time: 00:00:02 Returning block of 4254837 for bucket 78 bucket 96: 20% bucket 91: 30% Getting block 107 of 206 Reserving size (4425267) for bucket 107 Calculating Z arrays for bucket 107 Entering block accumulator loop for bucket 107: bucket 95: 20% Getting block 108 of 206 Reserving size (4425267) for bucket 108 Calculating Z arrays for bucket 108 Entering block accumulator loop for bucket 108: bucket 90: 30% bucket 86: 40% bucket 101: 20% bucket 99: 20% bucket 89: 40% bucket 87: 40% bucket 93: 30% bucket 97: 20% bucket 100: 20% bucket 88: 40% bucket 103: 20% bucket 94: 30% bucket 92: 30% bucket 83: 50% bucket 82: 60% bucket 85: 50% bucket 84: 50% bucket 104: 10% bucket 102: 20% bucket 91: 40% bucket 98: 30% bucket 95: 30% bucket 96: 30% bucket 105: 10% bucket 86: 50% bucket 107: 10% bucket 106: 10% bucket 108: 10% bucket 90: 40% bucket 101: 30% bucket 89: 50% bucket 87: 50% bucket 93: 40% bucket 99: 30% bucket 88: 50% bucket 97: 30% bucket 94: 40% bucket 92: 40% bucket 82: 70% bucket 103: 30% bucket 83: 60% bucket 84: 60% bucket 85: 60% bucket 100: 30% V-Sorting samples time: 00:00:07 Allocating rank array Ranking v-sort output bucket 95: 40% bucket 96: 40% bucket 98: 40% bucket 104: 20% bucket 91: 50% bucket 86: 60% bucket 105: 20% bucket 102: 30% bucket 107: 20% bucket 90: 50% bucket 89: 60% bucket 108: 20% bucket 93: 50% bucket 101: 40% bucket 87: 60% bucket 97: 40% bucket 99: 40% bucket 94: 50% bucket 106: 20% bucket 82: 80% bucket 88: 60% bucket 92: 50% bucket 83: 70% bucket 84: 70% bucket 85: 70% bucket 103: 40% bucket 100: 40% bucket 95: 50% bucket 96: 50% bucket 98: 50% bucket 86: 70% bucket 91: 60% bucket 105: 30% bucket 102: 40% bucket 90: 60% bucket 89: 70% bucket 93: 60% bucket 104: 30% bucket 107: 30% bucket 82: 90% bucket 108: 30% bucket 94: 60% bucket 97: 50% bucket 101: 50% bucket 99: 50% bucket 92: 60% bucket 83: 80% bucket 88: 70% bucket 85: 80% bucket 87: 70% bucket 84: 80% bucket 106: 30% bucket 103: 50% bucket 95: 60% bucket 96: 60% bucket 100: 50% bucket 86: 80% bucket 98: 60% bucket 91: 70% bucket 105: 40% bucket 90: 70% bucket 93: 70% bucket 82: 100% Sorting block of length 4234837 for bucket 82 (Using difference cover) bucket 89: 80% bucket 97: 60% bucket 94: 70% bucket 107: 40% bucket 101: 60% bucket 92: 70% bucket 83: 90% bucket 108: 40% bucket 102: 50% bucket 99: 60% bucket 104: 40% bucket 84: 90% bucket 85: 90% bucket 87: 80% bucket 88: 80% bucket 103: 60% bucket 95: 70% bucket 106: 40% bucket 96: 70% bucket 86: 90% bucket 91: 80% bucket 98: 70% bucket 105: 50% bucket 93: 80% bucket 90: 80% bucket 100: 60% bucket 89: 90% bucket 97: 70% bucket 94: 80% bucket 107: 50% bucket 92: 80% bucket 84: 100% Sorting block of length 909954 for bucket 84 (Using difference cover) bucket 101: 70% bucket 108: 50% bucket 83: 100% Sorting block of length 3757611 for bucket 83 (Using difference cover) bucket 102: 60% bucket 87: 90% bucket 85: 100% Sorting block of length 4279685 for bucket 85 (Using difference cover) bucket 99: 70% bucket 88: 90% bucket 104: 50% bucket 95: 80% bucket 103: 70% Sorting block time: 00:00:00 Returning block of 909955 for bucket 84 Getting block 109 of 206 Reserving size (4425267) for bucket 109 Calculating Z arrays for bucket 109 Entering block accumulator loop for bucket 109: bucket 96: 80% bucket 86: 100% Sorting block of length 3744321 for bucket 86 (Using difference cover) bucket 91: 90% bucket 106: 50% bucket 98: 80% Sorting block time: 00:00:01 Returning block of 4234838 for bucket 82 bucket 93: 90% bucket 105: 60% bucket 90: 90% Getting block 110 of 206 Reserving size (4425267) for bucket 110 Calculating Z arrays for bucket 110 Entering block accumulator loop for bucket 110: bucket 89: 100% Sorting block of length 2857981 for bucket 89 (Using difference cover) bucket 97: 80% bucket 94: 90% bucket 100: 70% bucket 92: 90% bucket 107: 60% bucket 108: 60% bucket 101: 80% bucket 102: 70% bucket 87: 100% Sorting block of length 3801286 for bucket 87 (Using difference cover) bucket 88: 100% Sorting block of length 4013069 for bucket 88 (Using difference cover) bucket 95: 90% bucket 99: 80% bucket 103: 80% bucket 96: 90% bucket 104: 60% bucket 91: 100% Sorting block of length 1752617 for bucket 91 (Using difference cover) bucket 109: 10% bucket 93: 100% Sorting block of length 1232473 for bucket 93 (Using difference cover) bucket 98: 90% bucket 106: 60% bucket 90: 100% Sorting block of length 4159204 for bucket 90 (Using difference cover) bucket 105: 70% bucket 94: 100% Sorting block of length 3743316 for bucket 94 (Using difference cover) bucket 97: 90% bucket 92: 100% Sorting block of length 3975822 for bucket 92 (Using difference cover) bucket 107: 70% bucket 100: 80% bucket 110: 10% bucket 101: 90% bucket 108: 70% Sorting block time: 00:00:01 Returning block of 3757612 for bucket 83 Sorting block time: 00:00:00 Returning block of 1232474 for bucket 93 bucket 95: 100% Sorting block of length 1702307 for bucket 95 (Using difference cover) bucket 102: 80% Getting block 111 of 206 Reserving size (4425267) for bucket 111 Calculating Z arrays for bucket 111 Entering block accumulator loop for bucket 111: Getting block 112 of 206 Reserving size (4425267) for bucket 112 Calculating Z arrays for bucket 112 Entering block accumulator loop for bucket 112: bucket 99: 90% bucket 96: 100% Sorting block of length 4335909 for bucket 96 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4279686 for bucket 85 bucket 103: 90% Sorting block time: 00:00:01 Returning block of 1752618 for bucket 91 Sorting block time: 00:00:02 Returning block of 2857982 for bucket 89 Sorting block time: 00:00:02 Returning block of 3744322 for bucket 86 Getting block 113 of 206 Reserving size (4425267) for bucket 113 Calculating Z arrays for bucket 113 Entering block accumulator loop for bucket 113: Getting block 114 of 206 Reserving size (4425267) for bucket 114 Calculating Z arrays for bucket 114 Entering block accumulator loop for bucket 114: Getting block 115 of 206 Reserving size (4425267) for bucket 115 Calculating Z arrays for bucket 115 Entering block accumulator loop for bucket 115: Getting block 116 of 206 Reserving size (4425267) for bucket 116 Calculating Z arrays for bucket 116 Entering block accumulator loop for bucket 116: bucket 109: 20% Ranking v-sort output time: 00:00:05 Invoking Larsson-Sadakane on ranks bucket 104: 70% bucket 98: 100% Sorting block of length 4308671 for bucket 98 (Using difference cover) bucket 106: 70% bucket 105: 80% bucket 97: 100% Sorting block of length 1460564 for bucket 97 (Using difference cover) bucket 100: 90% bucket 107: 80% bucket 110: 20% bucket 101: 100% Sorting block of length 3876281 for bucket 101 (Using difference cover) bucket 108: 80% bucket 102: 90% Sorting block time: 00:00:01 Returning block of 3801287 for bucket 87 bucket 111: 10% bucket 99: 100% Sorting block of length 3514928 for bucket 99 (Using difference cover) Getting block 117 of 206 Reserving size (4425267) for bucket 117 Calculating Z arrays for bucket 117 Entering block accumulator loop for bucket 117: Sorting block time: 00:00:01 Returning block of 4013070 for bucket 88 bucket 112: 10% bucket 103: 100% Sorting block of length 2477574 for bucket 103 (Using difference cover) bucket 113: 10% bucket 114: 10% bucket 115: 10% Sorting block time: 00:00:01 Returning block of 1702308 for bucket 95 bucket 116: 10% bucket 109: 30% Getting block 118 of 206 Reserving size (4425267) for bucket 118 Calculating Z arrays for bucket 118 Entering block accumulator loop for bucket 118: Getting block 119 of 206 Reserving size (4425267) for bucket 119 Calculating Z arrays for bucket 119 Entering block accumulator loop for bucket 119: bucket 105: 90% bucket 106: 80% Sorting block time: 00:00:01 Returning block of 1460565 for bucket 97 Getting block 120 of 206 Reserving size (4425267) for bucket 120 Calculating Z arrays for bucket 120 Entering block accumulator loop for bucket 120: bucket 104: 80% Sorting block time: 00:00:02 Returning block of 3975823 for bucket 92 bucket 100: 100% Sorting block of length 2562326 for bucket 100 (Using difference cover) Getting block 121 of 206 Reserving size (4425267) for bucket 121 Calculating Z arrays for bucket 121 Entering block accumulator loop for bucket 121: Sorting block time: 00:00:02 Returning block of 3743317 for bucket 94 bucket 107: 90% bucket 110: 30% Getting block 122 of 206 Reserving size (4425267) for bucket 122 Calculating Z arrays for bucket 122 Entering block accumulator loop for bucket 122: bucket 108: 90% Sorting block time: 00:00:02 Returning block of 4159205 for bucket 90 bucket 111: 20% bucket 102: 100% Sorting block of length 3855162 for bucket 102 (Using difference cover) bucket 112: 20% Getting block 123 of 206 Reserving size (4425267) for bucket 123 Calculating Z arrays for bucket 123 Entering block accumulator loop for bucket 123: bucket 117: 10% bucket 109: 40% bucket 114: 20% bucket 116: 20% bucket 118: 10% bucket 115: 20% bucket 105: 100% Sorting block of length 2352469 for bucket 105 (Using difference cover) bucket 113: 20% bucket 119: 10% bucket 106: 90% bucket 120: 10% Sorting block time: 00:00:01 Returning block of 2477575 for bucket 103 Getting block 124 of 206 Reserving size (4425267) for bucket 124 Calculating Z arrays for bucket 124 Entering block accumulator loop for bucket 124: bucket 121: 10% bucket 104: 90% bucket 110: 40% bucket 107: 100% Sorting block of length 1411439 for bucket 107 (Using difference cover) bucket 122: 10% bucket 108: 100% Sorting block of length 3655579 for bucket 108 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4308672 for bucket 98 bucket 111: 30% Sorting block time: 00:00:01 Returning block of 2562327 for bucket 100 Sorting block time: 00:00:02 Returning block of 3876282 for bucket 101 Sorting block time: 00:00:02 Returning block of 4335910 for bucket 96 Sorting block time: 00:00:02 Returning block of 3514929 for bucket 99 Getting block 125 of 206 Reserving size (4425267) for bucket 125 Calculating Z arrays for bucket 125 Entering block accumulator loop for bucket 125: Getting block 126 of 206 Reserving size (4425267) for bucket 126 Calculating Z arrays for bucket 126 Entering block accumulator loop for bucket 126: Getting block 127 of 206 Reserving size (4425267) for bucket 127 Calculating Z arrays for bucket 127 Entering block accumulator loop for bucket 127: bucket 117: 20% bucket 109: 50% bucket 123: 10% Getting block 128 of 206 Reserving size (4425267) for bucket 128 Calculating Z arrays for bucket 128 Entering block accumulator loop for bucket 128: bucket 116: 30% Getting block 129 of 206 Reserving size (4425267) for bucket 129 Calculating Z arrays for bucket 129 Entering block accumulator loop for bucket 129: bucket 114: 30% bucket 115: 30% bucket 118: 20% bucket 112: 30% bucket 119: 20% bucket 106: 100% Sorting block of length 3350535 for bucket 106 (Using difference cover) bucket 113: 30% bucket 120: 20% Sorting block time: 00:00:00 Returning block of 1411440 for bucket 107 Getting block 130 of 206 Reserving size (4425267) for bucket 130 Calculating Z arrays for bucket 130 Entering block accumulator loop for bucket 130: bucket 124: 10% bucket 121: 20% bucket 110: 50% Sorting block time: 00:00:02 Returning block of 2352470 for bucket 105 Getting block 131 of 206 Reserving size (4425267) for bucket 131 Calculating Z arrays for bucket 131 Entering block accumulator loop for bucket 131: bucket 122: 20% bucket 104: 100% Sorting block of length 3992871 for bucket 104 (Using difference cover) bucket 111: 40% bucket 125: 10% bucket 126: 10% bucket 116: 40% bucket 123: 20% bucket 109: 60% bucket 127: 10% Sorting block time: 00:00:02 Returning block of 3855163 for bucket 102 bucket 117: 30% bucket 129: 10% bucket 114: 40% bucket 118: 30% bucket 115: 40% bucket 112: 40% bucket 119: 30% Getting block 132 of 206 Reserving size (4425267) for bucket 132 Calculating Z arrays for bucket 132 Entering block accumulator loop for bucket 132: bucket 120: 30% bucket 113: 40% bucket 128: 10% bucket 124: 20% bucket 130: 10% bucket 121: 30% bucket 110: 60% Sorting block time: 00:00:01 Returning block of 3655580 for bucket 108 bucket 122: 30% bucket 131: 10% Getting block 133 of 206 Reserving size (4425267) for bucket 133 Calculating Z arrays for bucket 133 Entering block accumulator loop for bucket 133: bucket 111: 50% bucket 126: 20% bucket 125: 20% bucket 109: 70% Sorting block time: 00:00:02 Returning block of 3350536 for bucket 106 bucket 123: 30% bucket 117: 40% bucket 129: 20% bucket 118: 40% bucket 127: 20% bucket 119: 40% bucket 114: 50% bucket 115: 50% bucket 112: 50% bucket 120: 40% Getting block 134 of 206 Reserving size (4425267) for bucket 134 Calculating Z arrays for bucket 134 Entering block accumulator loop for bucket 134: bucket 113: 50% bucket 116: 50% bucket 128: 20% bucket 132: 10% bucket 124: 30% bucket 121: 40% bucket 110: 70% bucket 122: 40% bucket 130: 20% bucket 111: 60% bucket 131: 20% bucket 133: 10% Sorting block time: 00:00:02 Returning block of 3992872 for bucket 104 bucket 126: 30% bucket 109: 80% bucket 125: 30% bucket 123: 40% bucket 117: 50% bucket 119: 50% bucket 129: 30% bucket 118: 50% Getting block 135 of 206 Reserving size (4425267) for bucket 135 Calculating Z arrays for bucket 135 Entering block accumulator loop for bucket 135: bucket 120: 50% bucket 115: 60% bucket 114: 60% bucket 113: 60% bucket 116: 60% bucket 112: 60% bucket 124: 40% bucket 127: 30% bucket 128: 30% bucket 134: 10% bucket 132: 20% bucket 121: 50% bucket 110: 80% bucket 130: 30% bucket 122: 50% bucket 111: 70% bucket 109: 90% bucket 126: 40% bucket 123: 50% bucket 125: 40% bucket 131: 30% bucket 133: 20% bucket 119: 60% bucket 117: 60% bucket 129: 40% bucket 120: 60% bucket 115: 70% bucket 114: 70% bucket 113: 70% bucket 116: 70% bucket 118: 60% bucket 135: 10% bucket 112: 70% bucket 124: 50% bucket 128: 40% bucket 110: 90% bucket 127: 40% bucket 132: 30% bucket 134: 20% bucket 121: 60% bucket 130: 40% bucket 111: 80% bucket 122: 60% Invoking Larsson-Sadakane on ranks time: 00:00:06 Sanity-checking and returning Building samples Reserving space for 300 sample suffixes Generating random suffixes QSorting 300 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 300 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes bucket 119: 70% bucket 123: 60% bucket 117: 70% bucket 109: 100% Sorting block of length 2442292 for bucket 109 (Using difference cover) bucket 126: 50% bucket 129: 50% bucket 115: 80% bucket 125: 50% bucket 120: 70% bucket 110: 100% Sorting block of length 2664261 for bucket 110 (Using difference cover) bucket 131: 40% bucket 133: 30% bucket 114: 80% bucket 116: 80% bucket 113: 80% bucket 118: 70% bucket 124: 60% bucket 135: 20% bucket 128: 50% bucket 119: 80% bucket 112: 80% bucket 132: 40% bucket 125: 60% bucket 127: 50% bucket 129: 60% bucket 134: 30% bucket 121: 70% bucket 111: 90% bucket 117: 80% bucket 122: 70% bucket 130: 50% bucket 123: 70% bucket 119: 90% bucket 114: 90% bucket 115: 90% Sorting block time: 00:00:02 Returning block of 2442293 for bucket 109 bucket 126: 60% bucket 120: 80% Getting block 136 of 206 Reserving size (4425267) for bucket 136 Calculating Z arrays for bucket 136 Entering block accumulator loop for bucket 136: bucket 125: 70% bucket 129: 70% bucket 113: 90% bucket 131: 50% bucket 116: 90% bucket 133: 40% bucket 124: 70% bucket 118: 80% bucket 128: 60% bucket 121: 80% bucket 123: 80% Sorting block time: 00:00:02 Returning block of 2664262 for bucket 110 bucket 132: 50% bucket 112: 90% bucket 135: 30% Getting block 137 of 206 Reserving size (4425267) for bucket 137 Calculating Z arrays for bucket 137 Entering block accumulator loop for bucket 137: bucket 127: 60% bucket 111: 100% Sorting block of length 3016284 for bucket 111 (Using difference cover) bucket 117: 90% bucket 134: 40% bucket 114: 100% Sorting block of length 2907311 for bucket 114 (Using difference cover) bucket 125: 80% bucket 122: 80% bucket 119: 100% Sorting block of length 1359842 for bucket 119 (Using difference cover) bucket 115: 100% Sorting block of length 3457713 for bucket 115 (Using difference cover) bucket 130: 60% bucket 126: 70% bucket 136: 10% bucket 129: 80% bucket 113: 100% Sorting block of length 4026132 for bucket 113 (Using difference cover) bucket 123: 90% bucket 120: 90% Sorting block time: 00:00:00 Returning block of 1359843 for bucket 119 Getting block 138 of 206 Reserving size (4425267) for bucket 138 Calculating Z arrays for bucket 138 Entering block accumulator loop for bucket 138: bucket 128: 70% bucket 132: 60% bucket 121: 90% bucket 137: 10% bucket 117: 100% Sorting block of length 3287736 for bucket 117 (Using difference cover) bucket 124: 80% bucket 135: 40% bucket 131: 60% bucket 118: 90% bucket 116: 100% Sorting block of length 1582143 for bucket 116 (Using difference cover) bucket 133: 50% bucket 136: 20% bucket 123: 100% Sorting block of length 4164955 for bucket 123 (Using difference cover) bucket 112: 100% Sorting block of length 4288164 for bucket 112 (Using difference cover) bucket 129: 90% bucket 126: 80% bucket 125: 90% bucket 127: 70% bucket 134: 50% bucket 132: 70% Sorting block time: 00:00:02 Returning block of 3016285 for bucket 111 Getting block 139 of 206 Reserving size (4425267) for bucket 139 Calculating Z arrays for bucket 139 Entering block accumulator loop for bucket 139: Sorting block time: 00:00:02 Returning block of 2907312 for bucket 114 bucket 138: 10% bucket 128: 80% Getting block 140 of 206 Reserving size (4425267) for bucket 140 Calculating Z arrays for bucket 140 Entering block accumulator loop for bucket 140: bucket 122: 90% Sorting block time: 00:00:02 Returning block of 3457714 for bucket 115 bucket 130: 70% bucket 137: 20% bucket 120: 100% Sorting block of length 3152569 for bucket 120 (Using difference cover) Getting block 141 of 206 Reserving size (4425267) for bucket 141 Calculating Z arrays for bucket 141 Entering block accumulator loop for bucket 141: bucket 121: 100% Sorting block of length 4051170 for bucket 121 (Using difference cover) bucket 125: 100% Sorting block of length 4020570 for bucket 125 (Using difference cover) bucket 129: 100% Sorting block of length 3441489 for bucket 129 (Using difference cover) Sorting block time: 00:00:01 Returning block of 1582144 for bucket 116 bucket 136: 30% bucket 131: 70% Getting block 142 of 206 Reserving size (4425267) for bucket 142 Calculating Z arrays for bucket 142 Entering block accumulator loop for bucket 142: bucket 118: 100% Sorting block of length 4300084 for bucket 118 (Using difference cover) bucket 135: 50% Splitting and merging Splitting and merging time: 00:00:00 Split 38, merged 133; iterating... bucket 124: 90% bucket 133: 60% bucket 134: 60% bucket 140: 10% bucket 132: 80% bucket 139: 10% Sorting block time: 00:00:03 Returning block of 4026133 for bucket 113 bucket 138: 20% bucket 126: 90% bucket 137: 30% bucket 128: 90% bucket 127: 80% Getting block 143 of 206 Reserving size (4425267) for bucket 143 Calculating Z arrays for bucket 143 Entering block accumulator loop for bucket 143: bucket 122: 100% Sorting block of length 534294 for bucket 122 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3287737 for bucket 117 bucket 141: 10% Getting block 144 of 206 Reserving size (4425267) for bucket 144 Calculating Z arrays for bucket 144 Entering block accumulator loop for bucket 144: bucket 130: 80% bucket 136: 40% bucket 138: 30% bucket 131: 80% bucket 135: 60% Sorting block time: 00:00:01 Returning block of 534295 for bucket 122 bucket 139: 20% Getting block 145 of 206 Reserving size (4425267) for bucket 145 Calculating Z arrays for bucket 145 Entering block accumulator loop for bucket 145: bucket 142: 10% bucket 124: 100% Sorting block of length 2349557 for bucket 124 (Using difference cover) bucket 140: 20% bucket 132: 90% Sorting block time: 00:00:03 Returning block of 4288165 for bucket 112 bucket 133: 70% bucket 134: 70% Getting block 146 of 206 Reserving size (4425267) for bucket 146 Calculating Z arrays for bucket 146 Entering block accumulator loop for bucket 146: bucket 137: 40% bucket 126: 100% Sorting block of length 2304658 for bucket 126 (Using difference cover) bucket 128: 100% Sorting block of length 3177863 for bucket 128 (Using difference cover) Sorting block time: 00:00:04 Returning block of 4164956 for bucket 123 bucket 143: 10% Sorting block time: 00:00:03 Returning block of 3152570 for bucket 120 Getting block 147 of 206 Reserving size (4425267) for bucket 147 Calculating Z arrays for bucket 147 Entering block accumulator loop for bucket 147: bucket 127: 90% Getting block 148 of 206 Reserving size (4425267) for bucket 148 Calculating Z arrays for bucket 148 Entering block accumulator loop for bucket 148: bucket 144: 10% bucket 141: 20% bucket 135: 70% bucket 139: 30% Sorting block time: 00:00:03 Returning block of 3441490 for bucket 129 bucket 138: 40% bucket 136: 50% Sorting block time: 00:00:03 Returning block of 4020571 for bucket 125 bucket 130: 90% Getting block 149 of 206 Reserving size (4425267) for bucket 149 Calculating Z arrays for bucket 149 Entering block accumulator loop for bucket 149: bucket 131: 90% bucket 142: 20% Getting block 150 of 206 Reserving size (4425267) for bucket 150 Calculating Z arrays for bucket 150 Entering block accumulator loop for bucket 150: bucket 145: 10% Sorting block time: 00:00:04 Returning block of 4300085 for bucket 118 bucket 133: 80% bucket 140: 30% Getting block 151 of 206 Reserving size (4425267) for bucket 151 Calculating Z arrays for bucket 151 Entering block accumulator loop for bucket 151: bucket 146: 10% bucket 132: 100% Sorting block of length 4179319 for bucket 132 (Using difference cover) bucket 144: 20% bucket 147: 10% bucket 137: 50% Sorting block time: 00:00:02 Returning block of 2349558 for bucket 124 bucket 134: 80% Getting block 152 of 206 Reserving size (4425267) for bucket 152 Calculating Z arrays for bucket 152 Entering block accumulator loop for bucket 152: bucket 136: 60% bucket 143: 20% bucket 127: 100% Sorting block of length 4189233 for bucket 127 (Using difference cover) bucket 148: 10% Sorting block time: 00:00:02 Returning block of 2304659 for bucket 126 Getting block 153 of 206 Reserving size (4425267) for bucket 153 Calculating Z arrays for bucket 153 Entering block accumulator loop for bucket 153: Sorting block time: 00:00:03 Returning block of 3177864 for bucket 128 bucket 141: 30% Getting block 154 of 206 Reserving size (4425267) for bucket 154 Calculating Z arrays for bucket 154 Entering block accumulator loop for bucket 154: bucket 135: 80% bucket 139: 40% bucket 149: 10% bucket 138: 50% bucket 150: 10% bucket 131: 100% Sorting block of length 3527926 for bucket 131 (Using difference cover) bucket 145: 20% bucket 147: 20% bucket 142: 30% bucket 130: 100% Sorting block of length 3864333 for bucket 130 (Using difference cover) bucket 140: 40% Splitting and merging Splitting and merging time: 00:00:00 Split 19, merged 15; iterating... bucket 144: 30% bucket 146: 20% bucket 133: 90% bucket 136: 70% bucket 151: 10% bucket 137: 60% bucket 143: 30% bucket 141: 40% bucket 134: 90% bucket 139: 50% Sorting block time: 00:00:06 Returning block of 4051171 for bucket 121 bucket 154: 10% bucket 153: 10% bucket 152: 10% Getting block 155 of 206 Reserving size (4425267) for bucket 155 Calculating Z arrays for bucket 155 Entering block accumulator loop for bucket 155: bucket 148: 20% bucket 149: 20% bucket 135: 90% bucket 150: 20% bucket 142: 40% Sorting block time: 00:00:03 Returning block of 4179320 for bucket 132 bucket 138: 60% bucket 145: 30% bucket 147: 30% bucket 140: 50% bucket 133: 100% Sorting block of length 1323826 for bucket 133 (Using difference cover) Getting block 156 of 206 Reserving size (4425267) for bucket 156 Calculating Z arrays for bucket 156 Entering block accumulator loop for bucket 156: bucket 136: 80% bucket 144: 40% Sorting block time: 00:00:03 Returning block of 4189234 for bucket 127 bucket 143: 40% bucket 146: 30% Getting block 157 of 206 Reserving size (4425267) for bucket 157 Calculating Z arrays for bucket 157 Entering block accumulator loop for bucket 157: bucket 139: 60% bucket 151: 20% bucket 141: 50% bucket 137: 70% bucket 134: 100% Sorting block of length 3803477 for bucket 134 (Using difference cover) bucket 138: 70% Sorting block time: 00:00:03 Returning block of 3864334 for bucket 130 bucket 152: 20% bucket 153: 20% bucket 154: 20% bucket 155: 10% bucket 148: 30% Getting block 158 of 206 Reserving size (4425267) for bucket 158 Calculating Z arrays for bucket 158 Entering block accumulator loop for bucket 158: bucket 149: 30% bucket 150: 30% Sorting block time: 00:00:01 Returning block of 1323827 for bucket 133 Sorting block time: 00:00:03 Returning block of 3527927 for bucket 131 bucket 135: 100% Sorting block of length 2800661 for bucket 135 (Using difference cover) bucket 140: 60% Getting block 159 of 206 Reserving size (4425267) for bucket 159 Calculating Z arrays for bucket 159 Entering block accumulator loop for bucket 159: Getting block 160 of 206 Reserving size (4425267) for bucket 160 Calculating Z arrays for bucket 160 Entering block accumulator loop for bucket 160: bucket 145: 40% bucket 147: 40% bucket 156: 10% bucket 142: 50% bucket 144: 50% bucket 136: 90% bucket 143: 50% bucket 157: 10% bucket 146: 40% bucket 139: 70% bucket 141: 60% bucket 138: 80% bucket 151: 30% bucket 149: 40% bucket 137: 80% bucket 148: 40% bucket 152: 30% bucket 153: 30% bucket 154: 30% bucket 155: 20% bucket 147: 50% bucket 158: 10% bucket 150: 40% bucket 140: 70% bucket 145: 50% bucket 160: 10% bucket 159: 10% bucket 143: 60% bucket 144: 60% bucket 136: 100% Sorting block of length 4399691 for bucket 136 (Using difference cover) bucket 156: 20% bucket 142: 60% bucket 149: 50% Splitting and merging Splitting and merging time: 00:00:00 Split 11, merged 11; iterating... bucket 157: 20% bucket 138: 90% bucket 139: 80% bucket 151: 40% bucket 146: 50% bucket 141: 70% bucket 154: 40% bucket 153: 40% bucket 152: 40% bucket 158: 20% Sorting block time: 00:00:03 Returning block of 3803478 for bucket 134 bucket 137: 90% Getting block 161 of 206 Reserving size (4425267) for bucket 161 Calculating Z arrays for bucket 161 Entering block accumulator loop for bucket 161: bucket 142: 70% bucket 147: 60% Sorting block time: 00:00:03 Returning block of 2800662 for bucket 135 bucket 160: 20% bucket 148: 50% Getting block 162 of 206 Reserving size (4425267) for bucket 162 Calculating Z arrays for bucket 162 Entering block accumulator loop for bucket 162: bucket 159: 20% bucket 145: 60% bucket 150: 50% bucket 144: 70% bucket 140: 80% bucket 155: 30% bucket 143: 70% bucket 156: 30% bucket 151: 50% bucket 149: 60% bucket 138: 100% Sorting block of length 3904831 for bucket 138 (Using difference cover) bucket 157: 30% bucket 139: 90% bucket 158: 30% bucket 141: 80% bucket 146: 60% bucket 153: 50% bucket 152: 50% bucket 154: 50% bucket 161: 10% bucket 137: 100% Sorting block of length 3638093 for bucket 137 (Using difference cover) bucket 147: 70% bucket 142: 80% bucket 160: 30% bucket 148: 60% bucket 162: 10% bucket 145: 70% bucket 159: 30% bucket 150: 60% bucket 144: 80% bucket 155: 40% bucket 140: 90% bucket 143: 80% bucket 156: 40% Sorting block time: 00:00:04 Returning block of 4399692 for bucket 136 bucket 151: 60% bucket 149: 70% bucket 157: 40% Getting block 163 of 206 Reserving size (4425267) for bucket 163 Calculating Z arrays for bucket 163 Entering block accumulator loop for bucket 163: bucket 158: 40% bucket 139: 100% Sorting block of length 1745743 for bucket 139 (Using difference cover) bucket 141: 90% bucket 146: 70% bucket 153: 60% bucket 152: 60% bucket 154: 60% bucket 161: 20% bucket 160: 40% bucket 142: 90% bucket 162: 20% bucket 147: 80% bucket 145: 80% bucket 148: 70% bucket 150: 70% bucket 155: 50% bucket 159: 40% bucket 144: 90% bucket 140: 100% Sorting block of length 3703138 for bucket 140 (Using difference cover) bucket 143: 90% bucket 149: 80% bucket 156: 50% bucket 157: 50% bucket 163: 10% Sorting block time: 00:00:01 Returning block of 1745744 for bucket 139 bucket 151: 70% Splitting and merging Splitting and merging time: 00:00:00 Split 7, merged 7; iterating... Getting block 164 of 206 Reserving size (4425267) for bucket 164 Calculating Z arrays for bucket 164 Entering block accumulator loop for bucket 164: bucket 146: 80% bucket 141: 100% Sorting block of length 2636317 for bucket 141 (Using difference cover) Sorting block time: 00:00:04 Returning block of 3904832 for bucket 138 bucket 153: 70% bucket 158: 50% bucket 147: 90% bucket 152: 70% Getting block 165 of 206 Reserving size (4425267) for bucket 165 Calculating Z arrays for bucket 165 Entering block accumulator loop for bucket 165: Sorting block time: 00:00:03 Returning block of 3638094 for bucket 137 bucket 154: 70% Getting block 166 of 206 Reserving size (4425267) for bucket 166 Calculating Z arrays for bucket 166 Entering block accumulator loop for bucket 166: bucket 160: 50% bucket 161: 30% bucket 162: 30% bucket 148: 80% bucket 145: 90% bucket 144: 100% Sorting block of length 3096478 for bucket 144 (Using difference cover) bucket 155: 60% bucket 150: 80% bucket 159: 50% bucket 142: 100% Sorting block of length 3618522 for bucket 142 (Using difference cover) bucket 163: 20% bucket 143: 100% Sorting block of length 3161040 for bucket 143 (Using difference cover) bucket 157: 60% bucket 149: 90% bucket 153: 80% bucket 156: 60% bucket 164: 10% bucket 146: 90% bucket 158: 60% bucket 151: 80% bucket 147: 100% Sorting block of length 2915518 for bucket 147 (Using difference cover) bucket 152: 80% Sorting block time: 00:00:02 Returning block of 2636318 for bucket 141 Sorting block time: 00:00:03 Returning block of 3703139 for bucket 140 bucket 165: 10% Getting block 167 of 206 Reserving size (4425267) for bucket 167 Calculating Z arrays for bucket 167 Entering block accumulator loop for bucket 167: Getting block 168 of 206 Reserving size (4425267) for bucket 168 Calculating Z arrays for bucket 168 Entering block accumulator loop for bucket 168: bucket 160: 60% bucket 161: 40% bucket 154: 80% bucket 166: 10% bucket 162: 40% bucket 148: 90% bucket 155: 70% bucket 145: 100% Sorting block of length 2293016 for bucket 145 (Using difference cover) bucket 159: 60% bucket 163: 30% bucket 150: 90% bucket 157: 70% bucket 156: 70% bucket 149: 100% Sorting block of length 2628027 for bucket 149 (Using difference cover) bucket 153: 90% bucket 164: 20% bucket 158: 70% bucket 146: 100% Sorting block of length 3131983 for bucket 146 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3096479 for bucket 144 bucket 151: 90% Getting block 169 of 206 Reserving size (4425267) for bucket 169 Calculating Z arrays for bucket 169 Entering block accumulator loop for bucket 169: bucket 152: 90% bucket 165: 20% bucket 167: 10% Sorting block time: 00:00:02 Returning block of 3161041 for bucket 143 bucket 160: 70% bucket 161: 50% bucket 168: 10% Sorting block time: 00:00:02 Returning block of 3618523 for bucket 142 Getting block 170 of 206 Reserving size (4425267) for bucket 170 Calculating Z arrays for bucket 170 Entering block accumulator loop for bucket 170: bucket 162: 50% Getting block 171 of 206 Reserving size (4425267) for bucket 171 Calculating Z arrays for bucket 171 Entering block accumulator loop for bucket 171: bucket 154: 90% bucket 166: 20% Sorting block time: 00:00:03 Returning block of 2915519 for bucket 147 bucket 155: 80% bucket 148: 100% Sorting block of length 2341859 for bucket 148 (Using difference cover) Getting block 172 of 206 Reserving size (4425267) for bucket 172 Calculating Z arrays for bucket 172 Entering block accumulator loop for bucket 172: bucket 150: 100% Sorting block of length 2515328 for bucket 150 (Using difference cover) bucket 163: 40% bucket 159: 70% bucket 157: 80% Sorting block time: 00:00:02 Returning block of 2293017 for bucket 145 bucket 151: 100% Sorting block of length 1950013 for bucket 151 (Using difference cover) Getting block 173 of 206 Reserving size (4425267) for bucket 173 Calculating Z arrays for bucket 173 Entering block accumulator loop for bucket 173: bucket 156: 80% bucket 165: 30% bucket 164: 30% bucket 158: 80% Splitting and merging Splitting and merging time: 00:00:00 Split 4, merged 6; iterating... Avg bucket size: 3.17711e+06 (target: 4425266) Converting suffix-array elements to index image Allocating ftab, absorbFtab Entering Ebwt loop Getting block 1 of 208 Reserving size (4425267) for bucket 1 Getting block 2 of 208 Getting block 3 of 208 Getting block 4 of 208 Getting block 5 of 208 Getting block 6 of 208 Getting block 7 of 208 Getting block 8 of 208 Getting block 9 of 208 Getting block 10 of 208 Getting block 11 of 208 Getting block 12 of 208 Getting block 13 of 208 Getting block 14 of 208 Getting block 15 of 208 Getting block 16 of 208 Getting block 17 of 208 Getting block 18 of 208 Getting block 19 of 208 Calculating Z arrays for bucket 1 Reserving size (4425267) for bucket 2 Reserving size (4425267) for bucket 3 Reserving size (4425267) for bucket 4 Reserving size (4425267) for bucket 5 Reserving size (4425267) for bucket 6 Reserving size (4425267) for bucket 7 Reserving size (4425267) for bucket 8 Reserving size (4425267) for bucket 9 Reserving size (4425267) for bucket 10 Reserving size (4425267) for bucket 11 Reserving size (4425267) for bucket 12 Reserving size (4425267) for bucket 13 Getting block 20 of 208 Getting block 21 of 208 Reserving size (4425267) for bucket 14 Reserving size (4425267) for bucket 15 Reserving size (4425267) for bucket 16 Getting block 22 of 208 Reserving size (4425267) for bucket 17 Reserving size (4425267) for bucket 18 Reserving size (4425267) for bucket 19 Getting block 23 of 208 Getting block 24 of 208 Getting block 25 of 208 Getting block 26 of 208 Entering block accumulator loop for bucket 1: Calculating Z arrays for bucket 2 Calculating Z arrays for bucket 3 Calculating Z arrays for bucket 4 Calculating Z arrays for bucket 5 Calculating Z arrays for bucket 6 Calculating Z arrays for bucket 7 Calculating Z arrays for bucket 8 Getting block 27 of 208 Calculating Z arrays for bucket 9 Calculating Z arrays for bucket 10 Calculating Z arrays for bucket 11 Calculating Z arrays for bucket 12 Calculating Z arrays for bucket 13 Reserving size (4425267) for bucket 20 Reserving size (4425267) for bucket 21 Calculating Z arrays for bucket 14 Calculating Z arrays for bucket 15 Calculating Z arrays for bucket 16 Reserving size (4425267) for bucket 22 Calculating Z arrays for bucket 17 Calculating Z arrays for bucket 18 Calculating Z arrays for bucket 19 Reserving size (4425267) for bucket 23 Reserving size (4425267) for bucket 24 Reserving size (4425267) for bucket 25 Reserving size (4425267) for bucket 26 Entering block accumulator loop for bucket 2: Entering block accumulator loop for bucket 3: Entering block accumulator loop for bucket 4: Entering block accumulator loop for bucket 5: Entering block accumulator loop for bucket 6: Entering block accumulator loop for bucket 7: Reserving size (4425267) for bucket 27 Entering block accumulator loop for bucket 8: Entering block accumulator loop for bucket 9: Entering block accumulator loop for bucket 10: Entering block accumulator loop for bucket 11: Entering block accumulator loop for bucket 12: Calculating Z arrays for bucket 20 Entering block accumulator loop for bucket 13: Calculating Z arrays for bucket 21 Entering block accumulator loop for bucket 14: Calculating Z arrays for bucket 22 Entering block accumulator loop for bucket 15: Entering block accumulator loop for bucket 16: Entering block accumulator loop for bucket 17: Calculating Z arrays for bucket 23 Entering block accumulator loop for bucket 18: Entering block accumulator loop for bucket 19: Calculating Z arrays for bucket 24 Calculating Z arrays for bucket 25 Calculating Z arrays for bucket 26 Calculating Z arrays for bucket 27 Entering block accumulator loop for bucket 20: Entering block accumulator loop for bucket 21: Entering block accumulator loop for bucket 22: Entering block accumulator loop for bucket 23: Entering block accumulator loop for bucket 24: Entering block accumulator loop for bucket 25: Entering block accumulator loop for bucket 26: Entering block accumulator loop for bucket 27: bucket 153: 100% Sorting block of length 4357849 for bucket 153 (Using difference cover) bucket 152: 100% Sorting block of length 3631390 for bucket 152 (Using difference cover) bucket 169: 10% bucket 171: 10% bucket 160: 80% Sorting block time: 00:00:02 Returning block of 2628028 for bucket 149 bucket 170: 10% bucket 157: 90% bucket 161: 60% bucket 167: 20% bucket 168: 20% Getting block 174 of 206 Reserving size (4425267) for bucket 174 Calculating Z arrays for bucket 174 Entering block accumulator loop for bucket 174: bucket 159: 80% bucket 162: 60% bucket 13: 10% bucket 154: 100% Sorting block of length 4239492 for bucket 154 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3131984 for bucket 146 bucket 155: 90% Sorting block time: 00:00:01 Returning block of 2515329 for bucket 150 bucket 163: 50% bucket 166: 30% bucket 172: 10% Getting block 175 of 206 Reserving size (4425267) for bucket 175 Calculating Z arrays for bucket 175 Entering block accumulator loop for bucket 175: Getting block 176 of 206 Reserving size (4425267) for bucket 176 Calculating Z arrays for bucket 176 Entering block accumulator loop for bucket 176: bucket 156: 90% bucket 18: 10% bucket 3: 10% bucket 5: 10% bucket 4: 10% bucket 6: 10% bucket 9: 10% bucket 7: 10% bucket 8: 10% bucket 11: 10% bucket 2: 10% bucket 12: 10% bucket 1: 10% bucket 16: 10% bucket 165: 40% bucket 17: 10% bucket 10: 10% bucket 22: 10% bucket 24: 10% bucket 14: 10% bucket 15: 10% bucket 19: 10% bucket 164: 40% bucket 20: 10% bucket 23: 10% bucket 173: 10% bucket 26: 10% bucket 27: 10% Sorting block time: 00:00:02 Returning block of 1950014 for bucket 151 bucket 21: 10% bucket 158: 90% bucket 25: 10% Getting block 177 of 206 Reserving size (4425267) for bucket 177 Calculating Z arrays for bucket 177 Entering block accumulator loop for bucket 177: Sorting block time: 00:00:02 Returning block of 2341860 for bucket 148 bucket 171: 20% bucket 13: 20% Getting block 178 of 206 Reserving size (4425267) for bucket 178 Calculating Z arrays for bucket 178 Entering block accumulator loop for bucket 178: bucket 169: 20% bucket 157: 100% Sorting block of length 1147911 for bucket 157 (Using difference cover) bucket 160: 90% bucket 161: 70% bucket 167: 30% bucket 170: 20% bucket 168: 30% bucket 156: 100% Sorting block of length 4053100 for bucket 156 (Using difference cover) bucket 159: 90% bucket 174: 10% bucket 12: 20% bucket 162: 70% bucket 175: 10% bucket 3: 20% bucket 5: 20% bucket 18: 20% bucket 4: 20% bucket 2: 20% bucket 6: 20% bucket 8: 20% bucket 7: 20% bucket 9: 20% bucket 1: 20% bucket 11: 20% bucket 155: 100% Sorting block of length 1927333 for bucket 155 (Using difference cover) bucket 163: 60% bucket 16: 20% bucket 176: 10% bucket 17: 20% bucket 10: 20% bucket 165: 50% bucket 172: 20% bucket 15: 20% bucket 166: 40% bucket 14: 20% bucket 22: 20% bucket 20: 20% bucket 19: 20% bucket 24: 20% bucket 23: 20% bucket 26: 20% Sorting block time: 00:00:02 Returning block of 3631391 for bucket 152 bucket 27: 20% bucket 21: 20% bucket 25: 20% Getting block 179 of 206 Reserving size (4425267) for bucket 179 Calculating Z arrays for bucket 179 Entering block accumulator loop for bucket 179: bucket 13: 30% bucket 164: 50% bucket 173: 20% Sorting block time: 00:00:01 Returning block of 1147912 for bucket 157 bucket 158: 100% Sorting block of length 4315579 for bucket 158 (Using difference cover) bucket 177: 10% bucket 170: 30% Getting block 180 of 206 Reserving size (4425267) for bucket 180 Calculating Z arrays for bucket 180 Entering block accumulator loop for bucket 180: bucket 169: 30% bucket 17: 30% bucket 171: 30% bucket 3: 30% bucket 2: 30% bucket 12: 30% bucket 178: 10% bucket 5: 30% bucket 4: 30% Sorting block time: 00:00:03 Returning block of 4357850 for bucket 153 bucket 6: 30% bucket 1: 30% bucket 8: 30% bucket 18: 30% bucket 7: 30% bucket 9: 30% bucket 11: 30% Getting block 181 of 206 Reserving size (4425267) for bucket 181 Calculating Z arrays for bucket 181 Entering block accumulator loop for bucket 181: bucket 167: 40% bucket 160: 100% Sorting block of length 3808771 for bucket 160 (Using difference cover) bucket 161: 80% bucket 168: 40% bucket 10: 30% bucket 16: 30% bucket 15: 30% bucket 14: 30% bucket 162: 80% bucket 22: 30% bucket 159: 100% Sorting block of length 4354723 for bucket 159 (Using difference cover) bucket 174: 20% bucket 20: 30% bucket 175: 20% bucket 172: 30% bucket 23: 30% bucket 19: 30% bucket 24: 30% Sorting block time: 00:00:02 Returning block of 1927334 for bucket 155 bucket 163: 70% bucket 26: 30% bucket 21: 30% bucket 176: 20% bucket 27: 30% Getting block 182 of 206 Reserving size (4425267) for bucket 182 Calculating Z arrays for bucket 182 Entering block accumulator loop for bucket 182: bucket 165: 60% bucket 13: 40% bucket 25: 30% bucket 166: 50% bucket 17: 40% bucket 5: 40% bucket 2: 40% bucket 3: 40% bucket 1: 40% bucket 4: 40% bucket 9: 40% bucket 179: 10% Sorting block time: 00:00:04 Returning block of 4239493 for bucket 154 bucket 12: 40% bucket 6: 40% bucket 164: 60% bucket 8: 40% bucket 7: 40% bucket 18: 40% bucket 11: 40% bucket 173: 30% Getting block 183 of 206 Reserving size (4425267) for bucket 183 Calculating Z arrays for bucket 183 Entering block accumulator loop for bucket 183: bucket 177: 20% bucket 170: 40% bucket 180: 10% bucket 10: 40% bucket 15: 40% bucket 169: 40% bucket 172: 40% bucket 14: 40% bucket 16: 40% bucket 171: 40% bucket 178: 20% bucket 174: 30% bucket 22: 40% bucket 20: 40% bucket 19: 40% bucket 23: 40% bucket 181: 10% bucket 167: 50% bucket 24: 40% bucket 161: 90% bucket 168: 50% bucket 21: 40% bucket 2: 50% bucket 13: 50% bucket 26: 40% bucket 27: 40% bucket 162: 90% bucket 175: 30% bucket 25: 40% bucket 17: 50% Sorting block time: 00:00:03 Returning block of 4053101 for bucket 156 bucket 5: 50% bucket 3: 50% bucket 163: 80% bucket 1: 50% bucket 176: 30% bucket 9: 50% bucket 182: 10% bucket 4: 50% Getting block 184 of 206 Reserving size (4425267) for bucket 184 Calculating Z arrays for bucket 184 Entering block accumulator loop for bucket 184: bucket 165: 70% bucket 6: 50% bucket 8: 50% bucket 12: 50% bucket 7: 50% bucket 14: 50% bucket 11: 50% bucket 18: 50% bucket 166: 60% bucket 10: 50% bucket 16: 50% bucket 22: 50% bucket 179: 20% bucket 15: 50% bucket 172: 50% bucket 20: 50% bucket 183: 10% bucket 23: 50% bucket 164: 70% bucket 2: 60% bucket 173: 40% bucket 170: 50% bucket 177: 30% bucket 19: 50% bucket 9: 60% bucket 180: 20% bucket 24: 50% bucket 171: 50% bucket 178: 30% bucket 21: 50% bucket 13: 60% bucket 169: 50% bucket 26: 50% Sorting block time: 00:00:03 Returning block of 4315580 for bucket 158 bucket 174: 40% bucket 27: 50% bucket 5: 60% bucket 17: 60% bucket 25: 50% bucket 1: 60% bucket 3: 60% bucket 181: 20% Getting block 185 of 206 Reserving size (4425267) for bucket 185 Calculating Z arrays for bucket 185 Entering block accumulator loop for bucket 185: bucket 4: 60% bucket 167: 60% bucket 161: 100% Sorting block of length 4062454 for bucket 161 (Using difference cover) bucket 6: 60% bucket 14: 60% bucket 168: 60% bucket 8: 60% Sorting block time: 00:00:04 Returning block of 3808772 for bucket 160 bucket 162: 100% Sorting block of length 3899636 for bucket 162 (Using difference cover) bucket 12: 60% bucket 7: 60% bucket 175: 40% Getting block 186 of 206 Reserving size (4425267) for bucket 186 Calculating Z arrays for bucket 186 Entering block accumulator loop for bucket 186: bucket 11: 60% bucket 18: 60% bucket 176: 40% bucket 163: 90% bucket 10: 60% bucket 182: 20% bucket 2: 70% bucket 184: 10% bucket 165: 80% bucket 16: 60% bucket 22: 60% bucket 15: 60% bucket 172: 60% bucket 20: 60% bucket 23: 60% bucket 9: 70% bucket 19: 60% bucket 166: 70% bucket 174: 50% bucket 13: 70% bucket 21: 60% bucket 24: 60% bucket 179: 30% bucket 5: 70% bucket 1: 70% bucket 3: 70% bucket 26: 60% bucket 17: 70% bucket 164: 80% bucket 183: 20% bucket 4: 70% bucket 27: 60% bucket 177: 40% bucket 173: 50% bucket 25: 60% Sorting block time: 00:00:05 Returning block of 4354724 for bucket 159 bucket 170: 60% bucket 6: 70% bucket 180: 30% bucket 14: 70% bucket 8: 70% bucket 178: 40% bucket 171: 60% bucket 7: 70% Getting block 187 of 206 Reserving size (4425267) for bucket 187 Calculating Z arrays for bucket 187 Entering block accumulator loop for bucket 187: bucket 12: 70% bucket 169: 60% bucket 2: 80% bucket 163: 100% Sorting block of length 1558276 for bucket 163 (Using difference cover) bucket 11: 70% bucket 18: 70% bucket 185: 10% bucket 181: 30% bucket 167: 70% bucket 10: 70% bucket 168: 70% bucket 175: 50% bucket 22: 70% bucket 15: 70% bucket 16: 70% bucket 186: 10% bucket 20: 70% bucket 176: 50% bucket 9: 80% bucket 12: 80% bucket 23: 70% bucket 182: 30% bucket 1: 80% bucket 19: 70% bucket 5: 80% bucket 184: 20% bucket 165: 90% bucket 13: 80% bucket 21: 70% bucket 3: 80% bucket 4: 80% bucket 24: 70% bucket 172: 70% bucket 17: 80% bucket 6: 80% bucket 26: 70% bucket 8: 80% bucket 14: 80% bucket 25: 70% bucket 27: 70% bucket 7: 80% bucket 2: 90% bucket 174: 60% bucket 166: 80% bucket 179: 40% bucket 11: 80% bucket 177: 50% bucket 183: 30% bucket 18: 80% bucket 164: 90% Sorting block time: 00:00:02 Returning block of 1558277 for bucket 163 bucket 173: 60% bucket 170: 70% bucket 180: 40% bucket 178: 50% Getting block 188 of 206 Reserving size (4425267) for bucket 188 Calculating Z arrays for bucket 188 Entering block accumulator loop for bucket 188: bucket 10: 80% bucket 171: 70% bucket 187: 10% bucket 15: 80% bucket 169: 70% bucket 22: 80% bucket 16: 80% bucket 12: 90% bucket 175: 60% bucket 185: 20% bucket 9: 90% bucket 24: 80% bucket 20: 80% bucket 181: 40% bucket 167: 80% bucket 1: 90% bucket 5: 90% bucket 168: 80% bucket 3: 90% bucket 13: 90% bucket 23: 80% bucket 19: 80% Sorting block time: 00:00:03 Returning block of 3899637 for bucket 162 bucket 4: 90% bucket 21: 80% bucket 186: 20% Sorting block time: 00:00:03 Returning block of 4062455 for bucket 161 bucket 6: 90% bucket 176: 60% bucket 184: 30% bucket 17: 90% bucket 8: 90% Getting block 189 of 206 Reserving size (4425267) for bucket 189 Calculating Z arrays for bucket 189 Entering block accumulator loop for bucket 189: Getting block 190 of 206 Reserving size (4425267) for bucket 190 Calculating Z arrays for bucket 190 Entering block accumulator loop for bucket 190: bucket 7: 90% bucket 26: 80% bucket 182: 40% bucket 2: 100% Sorting block of length 4424383 for bucket 2 (Using difference cover) bucket 25: 80% bucket 27: 80% bucket 14: 90% bucket 165: 100% Sorting block of length 1836093 for bucket 165 (Using difference cover) bucket 11: 90% bucket 9: 100% Sorting block of length 2339643 for bucket 9 (Using difference cover) bucket 172: 80% bucket 18: 90% bucket 22: 90% bucket 10: 90% bucket 8: 100% Sorting block of length 4133938 for bucket 8 (Using difference cover) bucket 15: 90% bucket 174: 70% bucket 179: 50% bucket 24: 90% bucket 3: 100% Sorting block of length 7808695 for bucket 3 (Using difference cover) bucket 177: 60% bucket 16: 90% bucket 183: 40% bucket 12: 100% Sorting block of length 3372353 for bucket 12 (Using difference cover) bucket 1: 100% Sorting block of length 3461057 for bucket 1 (Using difference cover) bucket 20: 90% bucket 164: 100% Sorting block of length 3904472 for bucket 164 (Using difference cover) bucket 178: 60% bucket 170: 80% bucket 5: 100% Sorting block of length 2765684 for bucket 5 (Using difference cover) bucket 173: 70% bucket 180: 50% bucket 188: 10% bucket 166: 90% bucket 171: 80% bucket 13: 100% Sorting block of length 3994497 for bucket 13 (Using difference cover) bucket 4: 100% Sorting block of length 1756318 for bucket 4 (Using difference cover) bucket 187: 20% bucket 23: 90% bucket 169: 80% bucket 19: 90% bucket 6: 100% Sorting block of length 3150081 for bucket 6 (Using difference cover) bucket 21: 90% bucket 185: 30% bucket 175: 70% bucket 181: 50% bucket 17: 100% Sorting block of length 3705292 for bucket 17 (Using difference cover) bucket 190: 10% bucket 167: 90% bucket 7: 100% Sorting block of length 1809733 for bucket 7 (Using difference cover) bucket 168: 90% bucket 26: 90% bucket 189: 10% bucket 11: 100% Sorting block of length 2305995 for bucket 11 (Using difference cover) bucket 25: 90% bucket 14: 100% bucket 186: 30% Sorting block of length 2496945 for bucket 14 (Using difference cover) bucket 27: 90% bucket 176: 70% bucket 184: 40% bucket 18: 100% Sorting block of length 2585016 for bucket 18 (Using difference cover) bucket 10: 100% Sorting block of length 4074741 for bucket 10 (Using difference cover) bucket 182: 50% bucket 22: 100% Sorting block of length 2908593 for bucket 22 (Using difference cover) bucket 15: 100% Sorting block of length 3594453 for bucket 15 (Using difference cover) bucket 172: 90% bucket 24: 100% Sorting block of length 4333517 for bucket 24 (Using difference cover) bucket 16: 100% Sorting block of length 3665643 for bucket 16 (Using difference cover) bucket 20: 100% Sorting block of length 1136355 for bucket 20 (Using difference cover) bucket 174: 80% Sorting block time: 00:00:02 Returning block of 1836094 for bucket 165 Getting block 191 of 206 Reserving size (4425267) for bucket 191 Calculating Z arrays for bucket 191 Entering block accumulator loop for bucket 191: Sorting block time: 00:00:02 Returning block of 2339644 for bucket 9 bucket 179: 60% bucket 23: 100% Sorting block of length 2450721 for bucket 23 (Using difference cover) Getting block 28 of 208 Reserving size (4425267) for bucket 28 Calculating Z arrays for bucket 28 Entering block accumulator loop for bucket 28: bucket 177: 70% bucket 183: 50% bucket 178: 70% bucket 186: 40% bucket 21: 100% Sorting block of length 3380202 for bucket 21 (Using difference cover) bucket 180: 60% bucket 170: 90% bucket 173: 80% bucket 188: 20% bucket 19: 100% Sorting block of length 3914417 for bucket 19 (Using difference cover) bucket 171: 90% bucket 166: 100% Sorting block of length 3336715 for bucket 166 (Using difference cover) bucket 190: 20% bucket 187: 30% bucket 185: 40% bucket 26: 100% Sorting block of length 4351205 for bucket 26 (Using difference cover) bucket 169: 90% bucket 167: 100% Sorting block of length 4078738 for bucket 167 (Using difference cover) bucket 168: 100% Sorting block of length 3274279 for bucket 168 (Using difference cover) bucket 175: 80% bucket 25: 100% Sorting block of length 4072819 for bucket 25 (Using difference cover) Sorting block time: 00:00:02 Returning block of 1756319 for bucket 4 Sorting block time: 00:00:01 Returning block of 1809734 for bucket 7 bucket 27: 100% Sorting block of length 4243876 for bucket 27 (Using difference cover) bucket 181: 60% bucket 172: 100% Sorting block of length 1716374 for bucket 172 (Using difference cover) Sorting block time: 00:00:01 Returning block of 1136356 for bucket 20 bucket 189: 20% Sorting block time: 00:00:03 Returning block of 2765685 for bucket 5 bucket 176: 80% bucket 184: 50% Sorting block time: 00:00:02 Returning block of 2305996 for bucket 11 Sorting block time: 00:00:02 Returning block of 2496946 for bucket 14 bucket 182: 60% Sorting block time: 00:00:03 Returning block of 3372354 for bucket 12 Sorting block time: 00:00:02 Returning block of 3150082 for bucket 6 bucket 174: 90% bucket 28: 10% Getting block 29 of 208 Reserving size (4425267) for bucket 29 Calculating Z arrays for bucket 29 Entering block accumulator loop for bucket 29: Getting block 30 of 208 Reserving size (4425267) for bucket 30 Calculating Z arrays for bucket 30 Entering block accumulator loop for bucket 30: bucket 179: 70% Sorting block time: 00:00:03 Returning block of 4133939 for bucket 8 bucket 185: 50% Getting block 31 of 208 Reserving size (4425267) for bucket 31 Calculating Z arrays for bucket 31 Entering block accumulator loop for bucket 31: bucket 178: 80% Getting block 32 of 208 Reserving size (4425267) for bucket 32 Calculating Z arrays for bucket 32 Entering block accumulator loop for bucket 32: Getting block 33 of 208 Reserving size (4425267) for bucket 33 Calculating Z arrays for bucket 33 Entering block accumulator loop for bucket 33: Getting block 34 of 208 Reserving size (4425267) for bucket 34 Calculating Z arrays for bucket 34 Entering block accumulator loop for bucket 34: Getting block 35 of 208 Reserving size (4425267) for bucket 35 Calculating Z arrays for bucket 35 Entering block accumulator loop for bucket 35: Getting block 36 of 208 Reserving size (4425267) for bucket 36 Calculating Z arrays for bucket 36 Entering block accumulator loop for bucket 36: bucket 175: 90% Getting block 37 of 208 Reserving size (4425267) for bucket 37 Calculating Z arrays for bucket 37 Entering block accumulator loop for bucket 37: bucket 191: 10% Sorting block time: 00:00:03 Returning block of 2585017 for bucket 18 bucket 183: 60% bucket 177: 80% bucket 186: 50% Getting block 38 of 208 Reserving size (4425267) for bucket 38 Calculating Z arrays for bucket 38 Entering block accumulator loop for bucket 38: bucket 173: 90% Sorting block time: 00:00:02 Returning block of 1716375 for bucket 172 bucket 188: 30% bucket 180: 70% Sorting block time: 00:00:04 Returning block of 3904473 for bucket 164 bucket 171: 100% Sorting block of length 2356749 for bucket 171 (Using difference cover) bucket 170: 100% Sorting block of length 2677267 for bucket 170 (Using difference cover) Getting block 192 of 206 Reserving size (4425267) for bucket 192 Calculating Z arrays for bucket 192 Entering block accumulator loop for bucket 192: Sorting block time: 00:00:03 Returning block of 2908594 for bucket 22 bucket 190: 30% Getting block 39 of 208 Reserving size (4425267) for bucket 39 Calculating Z arrays for bucket 39 Entering block accumulator loop for bucket 39: Getting block 193 of 206 Reserving size (4425267) for bucket 193 Calculating Z arrays for bucket 193 Entering block accumulator loop for bucket 193: bucket 187: 40% bucket 169: 100% Sorting block of length 4243891 for bucket 169 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2450722 for bucket 23 bucket 178: 90% Sorting block time: 00:00:04 Returning block of 3994498 for bucket 13 bucket 181: 70% Getting block 40 of 208 Reserving size (4425267) for bucket 40 Calculating Z arrays for bucket 40 Entering block accumulator loop for bucket 40: Sorting block time: 00:00:02 Returning block of 3665644 for bucket 16 Sorting block time: 00:00:03 Returning block of 3705293 for bucket 17 Getting block 41 of 208 Reserving size (4425267) for bucket 41 Calculating Z arrays for bucket 41 Entering block accumulator loop for bucket 41: Getting block 42 of 208 Reserving size (4425267) for bucket 42 Calculating Z arrays for bucket 42 Entering block accumulator loop for bucket 42: Sorting block time: 00:00:03 Returning block of 4074742 for bucket 10 bucket 37: 10% bucket 176: 90% bucket 189: 30% bucket 179: 80% bucket 184: 60% Getting block 43 of 208 Reserving size (4425267) for bucket 43 Calculating Z arrays for bucket 43 Entering block accumulator loop for bucket 43: Getting block 44 of 208 Reserving size (4425267) for bucket 44 Calculating Z arrays for bucket 44 Entering block accumulator loop for bucket 44: bucket 188: 40% Sorting block time: 00:00:04 Returning block of 3594454 for bucket 15 bucket 182: 70% bucket 29: 10% bucket 28: 20% bucket 186: 60% bucket 33: 10% bucket 34: 10% Getting block 45 of 208 Reserving size (4425267) for bucket 45 Calculating Z arrays for bucket 45 Entering block accumulator loop for bucket 45: bucket 175: 100% Sorting block of length 4110622 for bucket 175 (Using difference cover) bucket 35: 10% bucket 185: 60% bucket 30: 10% bucket 32: 10% bucket 36: 10% bucket 31: 10% Sorting block time: 00:00:03 Returning block of 3336716 for bucket 166 bucket 38: 10% bucket 39: 10% bucket 37: 20% Getting block 194 of 206 Reserving size (4425267) for bucket 194 Calculating Z arrays for bucket 194 Entering block accumulator loop for bucket 194: bucket 191: 20% Sorting block time: 00:00:03 Returning block of 3914418 for bucket 19 bucket 183: 70% Sorting block time: 00:00:03 Returning block of 3380203 for bucket 21 bucket 174: 100% Sorting block of length 3813180 for bucket 174 (Using difference cover) Sorting block time: 00:00:05 Returning block of 4424384 for bucket 2 bucket 192: 10% bucket 190: 40% Getting block 46 of 208 Reserving size (4425267) for bucket 46 Calculating Z arrays for bucket 46 Entering block accumulator loop for bucket 46: bucket 180: 80% Getting block 47 of 208 Reserving size (4425267) for bucket 47 Calculating Z arrays for bucket 47 Entering block accumulator loop for bucket 47: Sorting block time: 00:00:03 Returning block of 3274280 for bucket 168 bucket 173: 100% Sorting block of length 3938072 for bucket 173 (Using difference cover) Getting block 48 of 208 Reserving size (4425267) for bucket 48 Calculating Z arrays for bucket 48 Entering block accumulator loop for bucket 48: Sorting block time: 00:00:04 Returning block of 4333518 for bucket 24 Getting block 195 of 206 Reserving size (4425267) for bucket 195 Calculating Z arrays for bucket 195 Entering block accumulator loop for bucket 195: bucket 178: 100% Sorting block of length 1532958 for bucket 178 (Using difference cover) bucket 193: 10% Getting block 49 of 208 Reserving size (4425267) for bucket 49 Calculating Z arrays for bucket 49 Entering block accumulator loop for bucket 49: bucket 187: 50% bucket 40: 10% bucket 41: 10% bucket 42: 10% Sorting block time: 00:00:02 Returning block of 2356750 for bucket 171 bucket 188: 50% bucket 177: 90% bucket 181: 80% Getting block 196 of 206 Reserving size (4425267) for bucket 196 Calculating Z arrays for bucket 196 Entering block accumulator loop for bucket 196: bucket 44: 10% bucket 29: 20% bucket 34: 20% bucket 176: 100% Sorting block of length 3232922 for bucket 176 (Using difference cover) bucket 39: 20% bucket 28: 30% bucket 43: 10% bucket 189: 40% Sorting block time: 00:00:04 Returning block of 4072820 for bucket 25 bucket 33: 20% bucket 37: 30% Sorting block time: 00:00:04 Returning block of 4078739 for bucket 167 bucket 179: 90% Sorting block time: 00:00:02 Returning block of 2677268 for bucket 170 Sorting block time: 00:00:04 Returning block of 4351206 for bucket 26 bucket 184: 70% bucket 30: 20% bucket 32: 20% bucket 35: 20% bucket 45: 10% Getting block 197 of 206 Reserving size (4425267) for bucket 197 Calculating Z arrays for bucket 197 Entering block accumulator loop for bucket 197: bucket 36: 20% Getting block 198 of 206 Reserving size (4425267) for bucket 198 Calculating Z arrays for bucket 198 Entering block accumulator loop for bucket 198: bucket 186: 70% bucket 38: 20% bucket 31: 20% Getting block 50 of 208 Reserving size (4425267) for bucket 50 Calculating Z arrays for bucket 50 Entering block accumulator loop for bucket 50: Getting block 51 of 208 Reserving size (4425267) for bucket 51 Calculating Z arrays for bucket 51 Entering block accumulator loop for bucket 51: bucket 185: 70% Sorting block time: 00:00:04 Returning block of 4243877 for bucket 27 bucket 182: 80% Getting block 52 of 208 Reserving size (4425267) for bucket 52 Calculating Z arrays for bucket 52 Entering block accumulator loop for bucket 52: bucket 194: 10% bucket 46: 10% bucket 191: 30% bucket 47: 10% bucket 183: 80% bucket 190: 50% bucket 48: 10% bucket 192: 20% Sorting block time: 00:00:01 Returning block of 1532959 for bucket 178 bucket 180: 90% Getting block 199 of 206 Reserving size (4425267) for bucket 199 Calculating Z arrays for bucket 199 Entering block accumulator loop for bucket 199: bucket 49: 10% bucket 40: 20% bucket 42: 20% bucket 38: 30% bucket 41: 20% bucket 195: 10% bucket 193: 20% bucket 187: 60% bucket 37: 40% bucket 29: 30% bucket 34: 30% bucket 188: 60% bucket 28: 40% Sorting block time: 00:00:07 Returning block of 7808696 for bucket 3 bucket 44: 20% bucket 33: 30% bucket 39: 30% bucket 177: 100% Sorting block of length 3571719 for bucket 177 (Using difference cover) bucket 181: 90% bucket 43: 20% bucket 196: 10% Sorting block time: 00:00:04 Returning block of 4243892 for bucket 169 bucket 36: 30% bucket 32: 30% bucket 35: 30% bucket 30: 30% Sorting block time: 00:00:08 Returning block of 3461058 for bucket 1 Getting block 200 of 206 Reserving size (4425267) for bucket 200 Calculating Z arrays for bucket 200 Entering block accumulator loop for bucket 200: Getting block 53 of 208 Reserving size (4425267) for bucket 53 Calculating Z arrays for bucket 53 Entering block accumulator loop for bucket 53: bucket 31: 30% bucket 45: 20% bucket 189: 50% bucket 179: 100% Sorting block of length 3580857 for bucket 179 (Using difference cover) bucket 184: 80% Getting block 54 of 208 Reserving size (4425267) for bucket 54 Calculating Z arrays for bucket 54 Entering block accumulator loop for bucket 54: bucket 50: 10% bucket 51: 10% bucket 198: 10% bucket 186: 80% bucket 197: 10% Sorting block time: 00:00:03 Returning block of 3938073 for bucket 173 bucket 185: 80% Getting block 201 of 206 Reserving size (4425267) for bucket 201 Calculating Z arrays for bucket 201 Entering block accumulator loop for bucket 201: bucket 46: 20% bucket 52: 10% bucket 182: 90% bucket 36: 40% Sorting block time: 00:00:03 Returning block of 4110623 for bucket 175 bucket 47: 20% bucket 191: 40% bucket 194: 20% bucket 183: 90% bucket 48: 20% bucket 190: 60% Getting block 202 of 206 Reserving size (4425267) for bucket 202 Calculating Z arrays for bucket 202 Entering block accumulator loop for bucket 202: bucket 42: 30% bucket 192: 30% bucket 199: 10% bucket 180: 100% Sorting block of length 1715082 for bucket 180 (Using difference cover) bucket 38: 40% bucket 40: 30% bucket 195: 20% bucket 193: 30% Sorting block time: 00:00:04 Returning block of 3813181 for bucket 174 bucket 49: 20% bucket 39: 40% bucket 188: 70% bucket 34: 40% bucket 187: 70% Getting block 203 of 206 Reserving size (4425267) for bucket 203 Calculating Z arrays for bucket 203 Entering block accumulator loop for bucket 203: bucket 28: 50% bucket 37: 50% bucket 31: 40% bucket 196: 20% bucket 43: 30% bucket 41: 30% Sorting block time: 00:00:03 Returning block of 3232923 for bucket 176 bucket 181: 100% Sorting block of length 3405550 for bucket 181 (Using difference cover) bucket 197: 20% bucket 200: 10% bucket 44: 30% bucket 29: 40% Getting block 204 of 206 Reserving size (4425267) for bucket 204 Calculating Z arrays for bucket 204 Entering block accumulator loop for bucket 204: bucket 198: 20% bucket 53: 10% bucket 184: 90% bucket 32: 40% bucket 186: 90% bucket 189: 60% bucket 35: 40% bucket 33: 40% bucket 185: 90% bucket 201: 10% bucket 182: 100% Sorting block of length 2929575 for bucket 182 (Using difference cover) bucket 45: 30% bucket 191: 50% bucket 36: 50% bucket 50: 20% bucket 194: 30% bucket 51: 20% bucket 46: 30% bucket 30: 40% bucket 190: 70% bucket 183: 100% Sorting block of length 3725854 for bucket 183 (Using difference cover) bucket 202: 10% bucket 54: 10% bucket 43: 40% bucket 192: 40% Sorting block time: 00:00:01 Returning block of 1715083 for bucket 180 Getting block 205 of 206 Reserving size (4425267) for bucket 205 Calculating Z arrays for bucket 205 Entering block accumulator loop for bucket 205: bucket 199: 20% bucket 31: 50% bucket 42: 40% bucket 193: 40% bucket 188: 80% bucket 195: 30% bucket 47: 30% bucket 38: 50% bucket 203: 10% bucket 187: 80% Sorting block time: 00:00:04 Returning block of 3571720 for bucket 177 bucket 196: 30% bucket 49: 30% bucket 197: 30% bucket 40: 40% Getting block 206 of 206 Reserving size (4425267) for bucket 206 Calculating Z arrays for bucket 206 Entering block accumulator loop for bucket 206: bucket 48: 30% bucket 186: 100% Sorting block of length 3573414 for bucket 186 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3580858 for bucket 179 bucket 34: 50% bucket 200: 20% bucket 204: 10% bucket 198: 30% bucket 52: 20% bucket 28: 60% bucket 184: 100% Sorting block of length 3402356 for bucket 184 (Using difference cover) bucket 39: 50% bucket 37: 60% bucket 185: 100% Sorting block of length 1107014 for bucket 185 (Using difference cover) bucket 201: 20% bucket 29: 50% bucket 189: 70% bucket 33: 50% bucket 191: 60% bucket 44: 40% bucket 190: 80% bucket 41: 40% bucket 45: 40% bucket 194: 40% bucket 202: 20% bucket 32: 50% bucket 46: 40% bucket 193: 50% bucket 192: 50% bucket 53: 20% bucket 196: 40% bucket 35: 50% bucket 205: 10% bucket 199: 30% bucket 206: 10% bucket 36: 60% bucket 48: 40% bucket 50: 30% bucket 188: 90% bucket 195: 40% bucket 42: 50% bucket 203: 20% Sorting block time: 00:00:03 Returning block of 2929576 for bucket 182 bucket 187: 90% Sorting block time: 00:00:02 Returning block of 1107015 for bucket 185 Sorting block time: 00:00:04 Returning block of 3405551 for bucket 181 bucket 197: 40% bucket 198: 40% bucket 200: 30% bucket 204: 20% bucket 30: 50% bucket 43: 50% bucket 28: 70% bucket 40: 50% bucket 51: 30% bucket 54: 20% bucket 201: 30% bucket 34: 60% bucket 47: 40% bucket 189: 80% bucket 31: 60% bucket 192: 60% bucket 49: 40% bucket 38: 60% Sorting block time: 00:00:03 Returning block of 3725855 for bucket 183 bucket 29: 60% bucket 37: 70% bucket 206: 20% bucket 52: 30% bucket 194: 50% bucket 190: 90% bucket 202: 30% bucket 191: 70% bucket 205: 20% bucket 32: 60% bucket 33: 60% bucket 44: 50% bucket 193: 60% bucket 203: 30% bucket 39: 60% bucket 196: 50% bucket 45: 50% bucket 199: 40% bucket 197: 50% bucket 41: 50% bucket 195: 50% bucket 188: 100% Sorting block of length 4405548 for bucket 188 (Using difference cover) bucket 48: 50% bucket 30: 60% bucket 187: 100% Sorting block of length 2543549 for bucket 187 (Using difference cover) bucket 198: 50% bucket 51: 40% bucket 200: 40% Sorting block time: 00:00:03 Returning block of 3402357 for bucket 184 bucket 204: 30% bucket 36: 70% Sorting block time: 00:00:04 Returning block of 3573415 for bucket 186 bucket 46: 50% bucket 35: 60% bucket 203: 40% bucket 206: 30% bucket 47: 50% bucket 201: 40% bucket 53: 30% bucket 34: 70% bucket 192: 70% bucket 28: 80% bucket 42: 60% bucket 202: 40% bucket 189: 90% bucket 43: 60% bucket 40: 60% bucket 194: 60% bucket 38: 70% bucket 31: 70% bucket 44: 60% bucket 195: 60% bucket 54: 30% bucket 50: 40% bucket 191: 80% bucket 29: 70% bucket 37: 80% bucket 190: 100% Sorting block of length 3177879 for bucket 190 (Using difference cover) bucket 197: 60% bucket 205: 30% bucket 193: 70% bucket 196: 60% bucket 199: 50% bucket 33: 70% bucket 39: 70% bucket 204: 40% bucket 206: 40% bucket 32: 70% bucket 202: 50% bucket 35: 70% bucket 36: 80% bucket 198: 60% bucket 52: 40% bucket 203: 50% bucket 49: 50% bucket 200: 50% bucket 41: 60% bucket 201: 50% bucket 51: 50% bucket 48: 60% bucket 46: 60% bucket 28: 90% bucket 192: 80% bucket 199: 60% bucket 45: 60% bucket 195: 70% Sorting block time: 00:00:03 Returning block of 2543550 for bucket 187 bucket 189: 100% Sorting block of length 4318144 for bucket 189 (Using difference cover) bucket 47: 60% bucket 43: 70% bucket 191: 90% bucket 194: 70% bucket 196: 70% bucket 38: 80% bucket 197: 70% bucket 206: 50% bucket 54: 40% bucket 53: 40% bucket 42: 70% bucket 30: 70% bucket 50: 50% bucket 205: 40% bucket 193: 80% bucket 198: 70% bucket 34: 80% bucket 192: 90% bucket 200: 60% bucket 40: 70% bucket 204: 50% bucket 37: 90% bucket 29: 80% bucket 31: 80% bucket 33: 80% bucket 202: 60% bucket 201: 60% bucket 49: 60% bucket 203: 60% bucket 206: 60% bucket 44: 70% bucket 36: 90% bucket 199: 70% bucket 35: 80% bucket 51: 60% bucket 48: 70% Sorting block time: 00:00:04 Returning block of 4405549 for bucket 188 bucket 194: 80% bucket 197: 80% bucket 28: 100% Sorting block of length 4021061 for bucket 28 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3177880 for bucket 190 bucket 195: 80% bucket 193: 90% bucket 41: 70% bucket 196: 80% bucket 191: 100% Sorting block of length 4344790 for bucket 191 (Using difference cover) bucket 38: 90% bucket 46: 70% bucket 205: 50% bucket 206: 70% bucket 34: 90% bucket 198: 80% bucket 199: 80% bucket 200: 70% bucket 54: 50% bucket 42: 80% bucket 32: 80% bucket 203: 70% bucket 204: 60% bucket 192: 100% Sorting block of length 2689022 for bucket 192 (Using difference cover) bucket 43: 80% bucket 202: 70% bucket 201: 70% bucket 52: 50% bucket 47: 70% bucket 197: 90% bucket 53: 50% bucket 48: 80% bucket 31: 90% bucket 39: 80% bucket 29: 90% bucket 49: 70% bucket 50: 60% bucket 45: 70% bucket 193: 100% Sorting block of length 4240393 for bucket 193 (Using difference cover) bucket 194: 90% bucket 36: 100% Sorting block of length 2747721 for bucket 36 (Using difference cover) bucket 44: 80% bucket 40: 80% bucket 198: 90% bucket 205: 60% bucket 206: 80% bucket 37: 100% Sorting block of length 4421118 for bucket 37 (Using difference cover) bucket 195: 90% bucket 204: 70% bucket 201: 80% bucket 202: 80% bucket 199: 90% bucket 200: 80% Sorting block time: 00:00:03 Returning block of 4318145 for bucket 189 bucket 196: 90% Sorting block time: 00:00:02 Returning block of 4021062 for bucket 28 bucket 30: 80% bucket 33: 90% bucket 203: 80% bucket 46: 80% Getting block 55 of 208 Reserving size (4425267) for bucket 55 Calculating Z arrays for bucket 55 Entering block accumulator loop for bucket 55: bucket 42: 90% bucket 51: 70% bucket 35: 90% bucket 197: 100% Sorting block of length 3391053 for bucket 197 (Using difference cover) bucket 43: 90% bucket 206: 90% bucket 34: 100% Sorting block of length 2719600 for bucket 34 (Using difference cover) bucket 38: 100% Sorting block of length 4038880 for bucket 38 (Using difference cover) bucket 54: 60% Sorting block time: 00:00:02 Returning block of 2689023 for bucket 192 bucket 198: 100% Sorting block of length 2164902 for bucket 198 (Using difference cover) bucket 205: 70% bucket 200: 90% bucket 40: 90% Sorting block time: 00:00:02 Returning block of 4344791 for bucket 191 bucket 32: 90% bucket 49: 80% bucket 31: 100% Sorting block of length 3265779 for bucket 31 (Using difference cover) bucket 41: 80% bucket 194: 100% Sorting block of length 3941992 for bucket 194 (Using difference cover) bucket 48: 90% bucket 204: 80% bucket 53: 60% bucket 47: 80% bucket 203: 90% bucket 202: 90% bucket 206: 100% Sorting block of length 4304873 for bucket 206 (Using difference cover) bucket 50: 70% bucket 196: 100% Sorting block of length 4308517 for bucket 196 (Using difference cover) Sorting block time: 00:00:02 Returning block of 2747722 for bucket 36 bucket 199: 100% Sorting block of length 3530413 for bucket 199 (Using difference cover) bucket 195: 100% Sorting block of length 3249664 for bucket 195 (Using difference cover) bucket 55: 10% bucket 201: 90% Getting block 56 of 208 Reserving size (4425267) for bucket 56 Calculating Z arrays for bucket 56 Entering block accumulator loop for bucket 56: bucket 45: 80% bucket 52: 60% bucket 44: 90% bucket 42: 100% Sorting block of length 3175188 for bucket 42 (Using difference cover) bucket 39: 90% bucket 43: 100% Sorting block of length 3951541 for bucket 43 (Using difference cover) bucket 205: 80% bucket 33: 100% Sorting block of length 1846083 for bucket 33 (Using difference cover) bucket 46: 90% Sorting block time: 00:00:02 Returning block of 4240394 for bucket 193 bucket 200: 100% Sorting block of length 3222212 for bucket 200 (Using difference cover) bucket 29: 100% Sorting block of length 1187006 for bucket 29 (Using difference cover) bucket 204: 90% bucket 30: 90% bucket 40: 100% Sorting block of length 2530379 for bucket 40 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4421119 for bucket 37 bucket 202: 100% Sorting block of length 3516509 for bucket 202 (Using difference cover) bucket 203: 100% Sorting block of length 3607685 for bucket 203 (Using difference cover) bucket 201: 100% Sorting block of length 4082685 for bucket 201 (Using difference cover) Getting block 57 of 208 Reserving size (4425267) for bucket 57 Calculating Z arrays for bucket 57 Entering block accumulator loop for bucket 57: bucket 54: 70% Sorting block time: 00:00:02 Returning block of 2719601 for bucket 34 bucket 48: 100% Sorting block of length 3182514 for bucket 48 (Using difference cover) Getting block 58 of 208 Reserving size (4425267) for bucket 58 Calculating Z arrays for bucket 58 Entering block accumulator loop for bucket 58: Sorting block time: 00:00:02 Returning block of 2164903 for bucket 198 Sorting block time: 00:00:02 Returning block of 3391054 for bucket 197 bucket 204: 100% Sorting block of length 4378272 for bucket 204 (Using difference cover) Sorting block time: 00:00:01 Returning block of 1187007 for bucket 29 Getting block 59 of 208 Reserving size (4425267) for bucket 59 Calculating Z arrays for bucket 59 Entering block accumulator loop for bucket 59: bucket 45: 90% bucket 35: 100% Sorting block of length 3771249 for bucket 35 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4038881 for bucket 38 Getting block 60 of 208 Reserving size (4425267) for bucket 60 Calculating Z arrays for bucket 60 Entering block accumulator loop for bucket 60: bucket 32: 100% Sorting block of length 4210390 for bucket 32 (Using difference cover) bucket 49: 90% bucket 47: 90% bucket 55: 20% bucket 51: 80% bucket 205: 90% Sorting block time: 00:00:02 Returning block of 1846084 for bucket 33 Getting block 61 of 208 Reserving size (4425267) for bucket 61 Calculating Z arrays for bucket 61 Entering block accumulator loop for bucket 61: bucket 56: 10% bucket 41: 90% Sorting block time: 00:00:03 Returning block of 3265780 for bucket 31 Sorting block time: 00:00:02 Returning block of 3222213 for bucket 200 Sorting block time: 00:00:02 Returning block of 3175189 for bucket 42 Getting block 62 of 208 Reserving size (4425267) for bucket 62 Calculating Z arrays for bucket 62 Entering block accumulator loop for bucket 62: bucket 39: 100% Sorting block of length 3354649 for bucket 39 (Using difference cover) Getting block 63 of 208 Reserving size (4425267) for bucket 63 Calculating Z arrays for bucket 63 Entering block accumulator loop for bucket 63: Sorting block time: 00:00:01 Returning block of 2530380 for bucket 40 Sorting block time: 00:00:03 Returning block of 3941993 for bucket 194 bucket 44: 100% Sorting block of length 4273609 for bucket 44 (Using difference cover) Getting block 64 of 208 Reserving size (4425267) for bucket 64 Calculating Z arrays for bucket 64 Entering block accumulator loop for bucket 64: bucket 46: 100% Sorting block of length 4091736 for bucket 46 (Using difference cover) Sorting block time: 00:00:03 Returning block of 3249665 for bucket 195 bucket 54: 80% Sorting block time: 00:00:03 Returning block of 3951542 for bucket 43 bucket 53: 70% bucket 58: 10% bucket 57: 10% bucket 50: 80% Getting block 65 of 208 Reserving size (4425267) for bucket 65 Calculating Z arrays for bucket 65 Entering block accumulator loop for bucket 65: bucket 205: 100% Sorting block of length 4372409 for bucket 205 (Using difference cover) Sorting block time: 00:00:03 Returning block of 4308518 for bucket 196 Sorting block time: 00:00:03 Returning block of 3530414 for bucket 199 bucket 45: 100% Sorting block of length 2921797 for bucket 45 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3516510 for bucket 202 Sorting block time: 00:00:02 Returning block of 3182515 for bucket 48 bucket 52: 70% bucket 59: 10% Getting block 66 of 208 Reserving size (4425267) for bucket 66 Calculating Z arrays for bucket 66 Entering block accumulator loop for bucket 66: bucket 55: 30% Sorting block time: 00:00:02 Returning block of 4082686 for bucket 201 Sorting block time: 00:00:02 Returning block of 3607686 for bucket 203 bucket 49: 100% Sorting block of length 4055882 for bucket 49 (Using difference cover) bucket 56: 20% bucket 60: 10% Sorting block time: 00:00:02 Returning block of 3771250 for bucket 35 Sorting block time: 00:00:02 Returning block of 4210391 for bucket 32 bucket 30: 100% Sorting block of length 3856410 for bucket 30 (Using difference cover) bucket 41: 100% Sorting block of length 4208272 for bucket 41 (Using difference cover) Getting block 67 of 208 Reserving size (4425267) for bucket 67 Calculating Z arrays for bucket 67 Entering block accumulator loop for bucket 67: bucket 63: 10% bucket 51: 90% Getting block 68 of 208 Reserving size (4425267) for bucket 68 Calculating Z arrays for bucket 68 Entering block accumulator loop for bucket 68: Sorting block time: 00:00:02 Returning block of 3354650 for bucket 39 bucket 47: 100% Sorting block of length 4239746 for bucket 47 (Using difference cover) bucket 61: 10% Getting block 69 of 208 Reserving size (4425267) for bucket 69 Calculating Z arrays for bucket 69 Entering block accumulator loop for bucket 69: bucket 58: 20% bucket 64: 10% bucket 65: 10% bucket 53: 80% bucket 62: 10% bucket 54: 90% Sorting block time: 00:00:03 Returning block of 4273610 for bucket 44 Sorting block time: 00:00:02 Returning block of 2921798 for bucket 45 Getting block 70 of 208 Reserving size (4425267) for bucket 70 Calculating Z arrays for bucket 70 Entering block accumulator loop for bucket 70: bucket 55: 40% Sorting block time: 00:00:02 Returning block of 4091737 for bucket 46 Sorting block time: 00:00:04 Returning block of 4378273 for bucket 204 Getting block 71 of 208 Reserving size (4425267) for bucket 71 Calculating Z arrays for bucket 71 Entering block accumulator loop for bucket 71: bucket 57: 20% Getting block 72 of 208 Reserving size (4425267) for bucket 72 Calculating Z arrays for bucket 72 Entering block accumulator loop for bucket 72: bucket 50: 90% bucket 56: 30% Sorting block time: 00:00:02 Returning block of 4055883 for bucket 49 bucket 59: 20% Getting block 73 of 208 Reserving size (4425267) for bucket 73 Calculating Z arrays for bucket 73 Entering block accumulator loop for bucket 73: Sorting block time: 00:00:02 Returning block of 3856411 for bucket 30 bucket 60: 20% bucket 52: 80% Getting block 74 of 208 Reserving size (4425267) for bucket 74 Calculating Z arrays for bucket 74 Entering block accumulator loop for bucket 74: Sorting block time: 00:00:02 Returning block of 4208273 for bucket 41 Sorting block time: 00:00:06 Returning block of 4304874 for bucket 206 Sorting block time: 00:00:03 Returning block of 4372410 for bucket 205 bucket 66: 10% Getting block 75 of 208 Reserving size (4425267) for bucket 75 Calculating Z arrays for bucket 75 Entering block accumulator loop for bucket 75: Sorting block time: 00:00:02 Returning block of 4239747 for bucket 47 Getting block 76 of 208 Reserving size (4425267) for bucket 76 Calculating Z arrays for bucket 76 Entering block accumulator loop for bucket 76: bucket 67: 10% bucket 68: 10% bucket 63: 20% bucket 64: 20% bucket 69: 10% bucket 54: 100% Sorting block of length 3630893 for bucket 54 (Using difference cover) bucket 58: 30% bucket 65: 20% bucket 55: 50% bucket 72: 10% bucket 71: 10% bucket 51: 100% Sorting block of length 2711519 for bucket 51 (Using difference cover) bucket 56: 40% bucket 61: 20% Exited Ebwt loop fchr[A]: 0 fchr[C]: 197284975 fchr[G]: 197284975 fchr[T]: 330645804 fchr[$]: 660839850 Exiting Ebwt::buildToDisk() Returning from initFromVector Wrote 224523443 bytes to primary EBWT file: BS_CT.rev.1.bt2 Wrote 165209968 bytes to secondary EBWT file: BS_CT.rev.2.bt2 Re-opening _in1 and _in2 as input streams Returning from Ebwt constructor Headers: len: 660839850 bwtLen: 660839851 sz: 165209963 bwtSz: 165209963 lineRate: 6 offRate: 4 offMask: 0xfffffff0 ftabChars: 10 eftabLen: 20 eftabSz: 80 ftabLen: 1048577 ftabSz: 4194308 offsLen: 41302491 offsSz: 165209964 lineSz: 64 sideSz: 64 sideBwtSz: 48 sideBwtLen: 192 numSides: 3441875 numLines: 3441875 ebwtTotLen: 220280000 ebwtTotSz: 220280000 color: 0 reverse: 1 Total time for backward call to driver() for mirror index: 00:02:37 bucket 53: 90% bucket 60: 30% bucket 57: 30% bucket 73: 10% Sorting block time: 00:00:01 Returning block of 2711520 for bucket 51 Getting block 77 of 208 Reserving size (4425267) for bucket 77 Calculating Z arrays for bucket 77 Entering block accumulator loop for bucket 77: bucket 74: 10% Sorting block time: 00:00:02 Returning block of 3630894 for bucket 54 Getting block 78 of 208 Reserving size (4425267) for bucket 78 Calculating Z arrays for bucket 78 Entering block accumulator loop for bucket 78: bucket 67: 20% bucket 63: 30% bucket 68: 20% bucket 64: 30% bucket 62: 20% bucket 50: 100% Sorting block of length 4399468 for bucket 50 (Using difference cover) bucket 69: 20% bucket 70: 10% bucket 55: 60% bucket 65: 30% bucket 72: 20% bucket 59: 30% bucket 56: 50% bucket 52: 90% bucket 57: 40% bucket 60: 40% bucket 66: 20% bucket 73: 20% Sorting block time: 00:00:02 Returning block of 4399469 for bucket 50 bucket 75: 10% Getting block 79 of 208 Reserving size (4425267) for bucket 79 Calculating Z arrays for bucket 79 Entering block accumulator loop for bucket 79: bucket 74: 20% bucket 76: 10% bucket 78: 10% bucket 67: 30% bucket 63: 40% bucket 68: 30% bucket 64: 40% bucket 58: 40% bucket 55: 70% bucket 69: 30% bucket 65: 40% bucket 71: 20% bucket 61: 30% bucket 72: 30% bucket 56: 60% bucket 53: 100% Sorting block of length 2096240 for bucket 53 (Using difference cover) bucket 57: 50% bucket 60: 50% bucket 77: 10% bucket 73: 30% Sorting block time: 00:00:01 Returning block of 2096241 for bucket 53 Getting block 80 of 208 Reserving size (4425267) for bucket 80 Calculating Z arrays for bucket 80 Entering block accumulator loop for bucket 80: bucket 74: 30% bucket 62: 30% bucket 78: 20% bucket 63: 50% bucket 67: 40% bucket 64: 50% bucket 68: 40% bucket 55: 80% bucket 69: 40% bucket 59: 40% bucket 70: 20% bucket 56: 70% bucket 65: 50% bucket 72: 40% bucket 52: 100% Sorting block of length 3554055 for bucket 52 (Using difference cover) bucket 57: 60% bucket 60: 60% bucket 66: 30% bucket 79: 10% bucket 75: 20% bucket 76: 20% bucket 73: 40% bucket 74: 40% bucket 58: 50% bucket 55: 90% bucket 63: 60% bucket 78: 30% bucket 67: 50% bucket 64: 60% bucket 68: 50% Sorting block time: 00:00:01 Returning block of 3554056 for bucket 52 Getting block 81 of 208 Reserving size (4425267) for bucket 81 Calculating Z arrays for bucket 81 Entering block accumulator loop for bucket 81: bucket 69: 50% bucket 61: 40% bucket 56: 80% bucket 72: 50% bucket 65: 60% bucket 71: 30% bucket 57: 70% bucket 60: 70% bucket 77: 20% bucket 73: 50% bucket 74: 50% bucket 62: 40% bucket 80: 10% bucket 55: 100% Sorting block of length 569854 for bucket 55 (Using difference cover) Sorting block time: 00:00:00 Returning block of 569855 for bucket 55 bucket 63: 70% Getting block 82 of 208 Reserving size (4425267) for bucket 82 Calculating Z arrays for bucket 82 Entering block accumulator loop for bucket 82: bucket 64: 70% bucket 78: 40% bucket 59: 50% bucket 68: 60% bucket 67: 60% bucket 69: 60% bucket 56: 90% bucket 70: 30% bucket 72: 60% bucket 66: 40% bucket 65: 70% bucket 57: 80% bucket 60: 80% bucket 58: 60% bucket 79: 20% bucket 75: 30% bucket 76: 30% bucket 73: 60% bucket 62: 50% bucket 63: 80% bucket 82: 10% bucket 64: 80% bucket 68: 70% bucket 81: 10% bucket 78: 50% bucket 61: 50% bucket 56: 100% Sorting block of length 4213755 for bucket 56 (Using difference cover) bucket 69: 70% bucket 71: 40% bucket 66: 50% bucket 65: 80% bucket 57: 90% bucket 60: 90% bucket 58: 70% bucket 77: 30% Sorting block time: 00:00:01 Returning block of 4213756 for bucket 56 bucket 74: 60% Getting block 83 of 208 Reserving size (4425267) for bucket 83 Calculating Z arrays for bucket 83 Entering block accumulator loop for bucket 83: bucket 59: 60% bucket 80: 20% bucket 73: 70% bucket 62: 60% bucket 63: 90% bucket 82: 20% bucket 64: 90% bucket 72: 70% bucket 68: 80% bucket 67: 70% bucket 78: 60% bucket 69: 80% bucket 66: 60% bucket 70: 40% bucket 57: 100% Sorting block of length 2699981 for bucket 57 (Using difference cover) bucket 65: 90% bucket 60: 100% Sorting block of length 4122632 for bucket 60 (Using difference cover) bucket 58: 80% bucket 79: 30% bucket 75: 40% Sorting block time: 00:00:01 Returning block of 2699982 for bucket 57 Getting block 84 of 208 Reserving size (4425267) for bucket 84 Calculating Z arrays for bucket 84 Entering block accumulator loop for bucket 84: bucket 76: 40% bucket 83: 10% bucket 61: 60% bucket 81: 20% bucket 73: 80% bucket 62: 70% bucket 63: 100% Sorting block of length 3079018 for bucket 63 (Using difference cover) bucket 82: 30% bucket 64: 100% Sorting block of length 3140723 for bucket 64 (Using difference cover) bucket 71: 50% bucket 68: 90% Sorting block time: 00:00:02 Returning block of 4122633 for bucket 60 Getting block 85 of 208 Reserving size (4425267) for bucket 85 Calculating Z arrays for bucket 85 Entering block accumulator loop for bucket 85: bucket 78: 70% bucket 66: 70% bucket 69: 90% bucket 59: 70% bucket 65: 100% Sorting block of length 3167904 for bucket 65 (Using difference cover) bucket 77: 40% bucket 58: 90% Sorting block time: 00:00:02 Returning block of 3079019 for bucket 63 bucket 74: 70% Sorting block time: 00:00:02 Returning block of 3140724 for bucket 64 Getting block 86 of 208 Reserving size (4425267) for bucket 86 Calculating Z arrays for bucket 86 Entering block accumulator loop for bucket 86: Getting block 87 of 208 Reserving size (4425267) for bucket 87 Calculating Z arrays for bucket 87 Entering block accumulator loop for bucket 87: bucket 72: 80% bucket 80: 30% bucket 67: 80% Sorting block time: 00:00:02 Returning block of 3167905 for bucket 65 bucket 84: 10% bucket 70: 50% Getting block 88 of 208 Reserving size (4425267) for bucket 88 Calculating Z arrays for bucket 88 Entering block accumulator loop for bucket 88: bucket 83: 20% bucket 79: 40% bucket 75: 50% bucket 62: 80% bucket 73: 90% bucket 82: 40% bucket 76: 50% bucket 68: 100% Sorting block of length 3615690 for bucket 68 (Using difference cover) bucket 61: 70% bucket 66: 80% bucket 85: 10% bucket 78: 80% bucket 69: 100% Sorting block of length 3762560 for bucket 69 (Using difference cover) bucket 81: 30% bucket 71: 60% bucket 58: 100% Sorting block of length 4095017 for bucket 58 (Using difference cover) bucket 86: 10% bucket 87: 10% bucket 59: 80% Sorting block time: 00:00:01 Returning block of 3615691 for bucket 68 bucket 77: 50% Getting block 89 of 208 Reserving size (4425267) for bucket 89 Calculating Z arrays for bucket 89 Entering block accumulator loop for bucket 89: bucket 74: 80% bucket 72: 90% bucket 84: 20% bucket 80: 40% bucket 67: 90% Sorting block time: 00:00:01 Returning block of 3762561 for bucket 69 bucket 83: 30% Getting block 90 of 208 Reserving size (4425267) for bucket 90 Calculating Z arrays for bucket 90 Entering block accumulator loop for bucket 90: bucket 88: 10% bucket 62: 90% bucket 70: 60% bucket 82: 50% Sorting block time: 00:00:02 Returning block of 4095018 for bucket 58 bucket 73: 100% Sorting block of length 3681284 for bucket 73 (Using difference cover) bucket 79: 50% Getting block 91 of 208 Reserving size (4425267) for bucket 91 Calculating Z arrays for bucket 91 Entering block accumulator loop for bucket 91: bucket 75: 60% bucket 66: 90% bucket 85: 20% bucket 78: 90% bucket 76: 60% bucket 61: 80% bucket 81: 40% bucket 86: 20% bucket 87: 20% bucket 71: 70% Sorting block time: 00:00:02 Returning block of 3681285 for bucket 73 Getting block 92 of 208 Reserving size (4425267) for bucket 92 Calculating Z arrays for bucket 92 Entering block accumulator loop for bucket 92: bucket 59: 90% bucket 89: 10% bucket 84: 30% bucket 83: 40% bucket 77: 60% bucket 90: 10% bucket 88: 20% bucket 62: 100% Sorting block of length 3581227 for bucket 62 (Using difference cover) bucket 72: 100% Sorting block of length 992331 for bucket 72 (Using difference cover) bucket 74: 90% bucket 82: 60% bucket 80: 50% bucket 67: 100% Sorting block of length 4413347 for bucket 67 (Using difference cover) bucket 66: 100% Sorting block of length 1389538 for bucket 66 (Using difference cover) Sorting block time: 00:00:01 Returning block of 992332 for bucket 72 Getting block 93 of 208 Reserving size (4425267) for bucket 93 Calculating Z arrays for bucket 93 Entering block accumulator loop for bucket 93: bucket 91: 10% bucket 85: 30% bucket 78: 100% Sorting block of length 4375496 for bucket 78 (Using difference cover) bucket 70: 70% Sorting block time: 00:00:01 Returning block of 1389539 for bucket 66 Getting block 94 of 208 Reserving size (4425267) for bucket 94 Calculating Z arrays for bucket 94 Entering block accumulator loop for bucket 94: bucket 79: 60% bucket 75: 70% bucket 61: 90% bucket 86: 30% bucket 76: 70% bucket 87: 30% Sorting block time: 00:00:02 Returning block of 3581228 for bucket 62 Getting block 95 of 208 Reserving size (4425267) for bucket 95 Calculating Z arrays for bucket 95 Entering block accumulator loop for bucket 95: bucket 81: 50% Sorting block time: 00:00:02 Returning block of 4413348 for bucket 67 bucket 92: 10% Getting block 96 of 208 Reserving size (4425267) for bucket 96 Calculating Z arrays for bucket 96 Entering block accumulator loop for bucket 96: bucket 84: 40% bucket 83: 50% bucket 71: 80% bucket 89: 20% bucket 59: 100% Sorting block of length 4089079 for bucket 59 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4375497 for bucket 78 Getting block 97 of 208 Reserving size (4425267) for bucket 97 Calculating Z arrays for bucket 97 Entering block accumulator loop for bucket 97: bucket 90: 20% bucket 82: 70% bucket 88: 30% bucket 77: 70% bucket 85: 40% bucket 74: 100% Sorting block of length 3651711 for bucket 74 (Using difference cover) bucket 91: 20% bucket 80: 60% Sorting block time: 00:00:02 Returning block of 4089080 for bucket 59 Getting block 98 of 208 Reserving size (4425267) for bucket 98 Calculating Z arrays for bucket 98 Entering block accumulator loop for bucket 98: bucket 94: 10% bucket 93: 10% bucket 86: 40% bucket 87: 40% bucket 79: 70% bucket 70: 80% bucket 75: 80% bucket 95: 10% bucket 61: 100% Sorting block of length 1555304 for bucket 61 (Using difference cover) Sorting block time: 00:00:01 Returning block of 3651712 for bucket 74 bucket 83: 60% bucket 84: 50% Getting block 99 of 208 Reserving size (4425267) for bucket 99 Calculating Z arrays for bucket 99 Entering block accumulator loop for bucket 99: bucket 76: 80% bucket 92: 20% bucket 89: 30% Sorting block time: 00:00:01 Returning block of 1555305 for bucket 61 Getting block 100 of 208 Reserving size (4425267) for bucket 100 Calculating Z arrays for bucket 100 Entering block accumulator loop for bucket 100: bucket 81: 60% bucket 82: 80% bucket 71: 90% bucket 97: 10% bucket 90: 30% bucket 96: 10% bucket 88: 40% bucket 85: 50% bucket 91: 30% bucket 77: 80% bucket 94: 20% bucket 80: 70% bucket 86: 50% bucket 87: 50% bucket 98: 10% bucket 83: 70% bucket 84: 60% bucket 79: 80% bucket 95: 20% bucket 93: 20% bucket 70: 90% bucket 75: 90% bucket 89: 40% bucket 92: 30% bucket 82: 90% bucket 76: 90% bucket 99: 10% bucket 81: 70% bucket 90: 40% bucket 97: 20% bucket 88: 50% bucket 100: 10% bucket 85: 60% bucket 71: 100% Sorting block of length 3771089 for bucket 71 (Using difference cover) bucket 96: 20% bucket 91: 40% bucket 86: 60% bucket 94: 30% bucket 77: 90% bucket 87: 60% bucket 83: 80% Sorting block time: 00:00:02 Returning block of 3771090 for bucket 71 Getting block 101 of 208 Reserving size (4425267) for bucket 101 Calculating Z arrays for bucket 101 Entering block accumulator loop for bucket 101: bucket 84: 70% bucket 80: 80% bucket 95: 30% bucket 79: 90% bucket 89: 50% bucket 75: 100% Sorting block of length 3543465 for bucket 75 (Using difference cover) bucket 82: 100% Sorting block of length 3121048 for bucket 82 (Using difference cover) bucket 92: 40% bucket 98: 20% bucket 70: 100% Sorting block of length 2581800 for bucket 70 (Using difference cover) bucket 93: 30% bucket 76: 100% Sorting block of length 4228406 for bucket 76 (Using difference cover) bucket 90: 50% bucket 85: 70% bucket 88: 60% bucket 97: 30% bucket 81: 80% bucket 99: 20% bucket 100: 20% Sorting block time: 00:00:02 Returning block of 3121049 for bucket 82 Sorting block time: 00:00:02 Returning block of 2581801 for bucket 70 Getting block 102 of 208 Reserving size (4425267) for bucket 102 Calculating Z arrays for bucket 102 Entering block accumulator loop for bucket 102: Getting block 103 of 208 Reserving size (4425267) for bucket 103 Calculating Z arrays for bucket 103 Entering block accumulator loop for bucket 103: bucket 91: 50% bucket 86: 70% Sorting block time: 00:00:02 Returning block of 3543466 for bucket 75 Getting block 104 of 208 Reserving size (4425267) for bucket 104 Calculating Z arrays for bucket 104 Entering block accumulator loop for bucket 104: bucket 94: 40% bucket 87: 70% bucket 96: 30% bucket 83: 90% bucket 84: 80% bucket 77: 100% Sorting block of length 3214379 for bucket 77 (Using difference cover) Sorting block time: 00:00:01 Returning block of 4228407 for bucket 76 Getting block 105 of 208 Reserving size (4425267) for bucket 105 Calculating Z arrays for bucket 105 Entering block accumulator loop for bucket 105: bucket 101: 10% bucket 95: 40% bucket 80: 90% bucket 89: 60% bucket 92: 50% bucket 79: 100% Sorting block of length 3222365 for bucket 79 (Using difference cover) Sorting block time: 00:00:02 Returning block of 3214380 for bucket 77 Getting block 106 of 208 Reserving size (4425267) for bucket 106 Calculating Z arrays for bucket 106 Entering block accumulator loop for bucket 106: bucket 85: 80% bucket 90: 60% bucket 88: 70% bucket 97: 40% bucket 93: 40% bucket 103: 10% bucket 98: 30% bucket 81: 90% bucket 86: 80% bucket 102: 10% Sorting block time: 00:00:01 Returning block of 3222366 for bucket 79 bucket 91: 60% Getting block 107 of 208 Reserving size (4425267) for bucket 107 Calculating Z arrays for bucket 107 Entering block accumulator loop for bucket 107: bucket 83: 100% Sorting block of length 1920014 for bucket 83 (Using difference cover) bucket 94: 50% bucket 87: 80% bucket 104: 10% bucket 100: 30% bucket 84: 90% bucket 99: 30% bucket 105: 10% bucket 101: 20% bucket 95: 50% bucket 96: 40% bucket 89: 70% Sorting block time: 00:00:01 Returning block of 1920015 for bucket 83 Getting block 108 of 208 Reserving size (4425267) for bucket 108 Calculating Z arrays for bucket 108 Entering block accumulator loop for bucket 108: bucket 92: 60% bucket 80: 100% Sorting block of length 2484296 for bucket 80 (Using difference cover) bucket 85: 90% bucket 103: 20% bucket 106: 10% bucket 88: 80% bucket 90: 70% bucket 97: 50% Sorting block time: 00:00:01 Returning block of 2484297 for bucket 80 bucket 86: 90% Getting block 109 of 208 Reserving size (4425267) for bucket 109 Calculating Z arrays for bucket 109 Entering block accumulator loop for bucket 109: bucket 93: 50% bucket 91: 70% bucket 102: 20% bucket 107: 10% bucket 81: 100% Sorting block of length 2093529 for bucket 81 (Using difference cover) bucket 87: 90% bucket 94: 60% bucket 98: 40% bucket 84: 100% Sorting block of length 3114651 for bucket 84 (Using difference cover) bucket 104: 20% bucket 108: 10% bucket 100: 40% Sorting block time: 00:00:01 Returning block of 2093530 for bucket 81 Getting block 110 of 208 Reserving size (4425267) for bucket 110 Calculating Z arrays for bucket 110 Entering block accumulator loop for bucket 110: bucket 89: 80% bucket 101: 30% bucket 99: 40% bucket 105: 20% bucket 95: 60% bucket 103: 30% bucket 85: 100% Sorting block of length 2844995 for bucket 85 (Using difference cover) bucket 92: 70% Sorting block time: 00:00:02 Returning block of 3114652 for bucket 84 bucket 96: 50% Getting block 111 of 208 Reserving size (4425267) for bucket 111 Calculating Z arrays for bucket 111 Entering block accumulator loop for bucket 111: bucket 88: 90% bucket 90: 80% bucket 109: 10% bucket 97: 60% bucket 106: 20% bucket 86: 100% Sorting block of length 4124582 for bucket 86 (Using difference cover) bucket 91: 80% bucket 87: 100% Sorting block of length 3195338 for bucket 87 (Using difference cover) bucket 94: 70% bucket 102: 30% bucket 107: 20% bucket 108: 20% bucket 104: 30% bucket 93: 60% bucket 89: 90% bucket 103: 40% Sorting block time: 00:00:02 Returning block of 2844996 for bucket 85 Getting block 112 of 208 Reserving size (4425267) for bucket 112 Calculating Z arrays for bucket 112 Entering block accumulator loop for bucket 112: bucket 110: 10% bucket 98: 50% Sorting block time: 00:00:01 Returning block of 4124583 for bucket 86 Getting block 113 of 208 Reserving size (4425267) for bucket 113 Calculating Z arrays for bucket 113 Entering block accumulator loop for bucket 113: bucket 101: 40% bucket 111: 10% Sorting block time: 00:00:02 Returning block of 3195339 for bucket 87 bucket 109: 20% bucket 105: 30% bucket 100: 50% Getting block 114 of 208 Reserving size (4425267) for bucket 114 Calculating Z arrays for bucket 114 Entering block accumulator loop for bucket 114: bucket 92: 80% bucket 88: 100% Sorting block of length 3847061 for bucket 88 (Using difference cover) bucket 99: 50% bucket 90: 90% bucket 95: 70% bucket 97: 70% bucket 96: 60% bucket 106: 30% bucket 108: 30% bucket 94: 80% bucket 91: 90% bucket 102: 40% bucket 107: 30% bucket 103: 50% bucket 112: 10% Sorting block time: 00:00:02 Returning block of 3847062 for bucket 88 Getting block 115 of 208 Reserving size (4425267) for bucket 115 Calculating Z arrays for bucket 115 Entering block accumulator loop for bucket 115: bucket 113: 10% bucket 104: 40% bucket 111: 20% bucket 89: 100% Sorting block of length 3546820 for bucket 89 (Using difference cover) bucket 109: 30% bucket 110: 20% bucket 114: 10% bucket 101: 50% bucket 93: 70% bucket 92: 90% bucket 105: 40% bucket 98: 60% bucket 90: 100% Sorting block of length 3260289 for bucket 90 (Using difference cover) bucket 97: 80% bucket 108: 40% bucket 100: 60% Sorting block time: 00:00:02 Returning block of 3546821 for bucket 89 Getting block 116 of 208 Reserving size (4425267) for bucket 116 Calculating Z arrays for bucket 116 Entering block accumulator loop for bucket 116: bucket 106: 40% bucket 95: 80% bucket 99: 60% bucket 94: 90% bucket 91: 100% Sorting block of length 3575578 for bucket 91 (Using difference cover) bucket 112: 20% bucket 103: 60% bucket 115: 10% bucket 113: 20% bucket 109: 40% bucket 111: 30% bucket 96: 70% Sorting block time: 00:00:02 Returning block of 3260290 for bucket 90 Getting block 117 of 208 Reserving size (4425267) for bucket 117 Calculating Z arrays for bucket 117 Entering block accumulator loop for bucket 117: bucket 107: 40% bucket 102: 50% bucket 104: 50% bucket 114: 20% bucket 110: 30% Sorting block time: 00:00:02 Returning block of 3575579 for bucket 91 Getting block 118 of 208 Reserving size (4425267) for bucket 118 Calculating Z arrays for bucket 118 Entering block accumulator loop for bucket 118: bucket 101: 60% bucket 92: 100% Sorting block of length 2383444 for bucket 92 (Using difference cover) bucket 108: 50% bucket 105: 50% bucket 116: 10% bucket 93: 80% bucket 97: 90% bucket 112: 30% bucket 109: 50% bucket 103: 70% bucket 111: 40% bucket 113: 30% bucket 98: 70% Sorting block time: 00:00:01 Returning block of 2383445 for bucket 92 bucket 115: 20% bucket 100: 70% bucket 106: 50% bucket 94: 100% Sorting block of length 4013485 for bucket 94 (Using difference cover) Getting block 119 of 208 Reserving size (4425267) for bucket 119 Calculating Z arrays for bucket 119 Entering block accumulator loop for bucket 119: bucket 117: 10% bucket 95: 90% bucket 107: 50% bucket 102: 60% bucket 99: 70% bucket 114: 30% bucket 104: 60% bucket 96: 80% bucket 118: 10% bucket 108: 60% bucket 110: 40% Sorting block time: 00:00:02 Returning block of 4013486 for bucket 94 Getting block 120 of 208 Reserving size (4425267) for bucket 120 Calculating Z arrays for bucket 120 Entering block accumulator loop for bucket 120: bucket 116: 20% bucket 101: 70% bucket 112: 40% bucket 109: 60% bucket 105: 60% bucket 97: 100% Sorting block of length 2050470 for bucket 97 (Using difference cover) bucket 111: 50% bucket 103: 80% bucket 113: 40% bucket 115: 30% bucket 93: 90% bucket 119: 10% bucket 117: 20% bucket 106: 60% bucket 100: 80% bucket 98: 80% bucket 107: 60% bucket 114: 40% bucket 102: 70% bucket 95: 100% Sorting block of length 1494407 for bucket 95 (Using difference cover) bucket 104: 70% bucket 108: 70% bucket 110: 50% bucket 118: 20% bucket 120: 10% bucket 99: 80% bucket 96: 90% bucket 101: 80% bucket 116: 30% bucket 109: 70% bucket 112: 50% bucket 105: 70% bucket 111: 60% bucket 113: 50% bucket 103: 90% Sorting block time: 00:00:01 Returning block of 2050471 for bucket 97 bucket 115: 40% Getting block 121 of 208 Reserving size (4425267) for bucket 121 Calculating Z arrays for bucket 121 Entering block accumulator loop for bucket 121: bucket 119: 20% bucket 106: 70% bucket 117: 30% bucket 93: 100% Sorting block of length 4170628 for bucket 93 (Using difference cover) bucket 107: 70% bucket 102: 80% bucket 114: 50% bucket 100: 90% Sorting block time: 00:00:01 Returning block of 1494408 for bucket 95 bucket 104: 80% Getting block 122 of 208 Reserving size (4425267) for bucket 122 Calculating Z arrays for bucket 122 Entering block accumulator loop for bucket 122: bucket 98: 90% bucket 110: 60% bucket 108: 80% bucket 120: 20% bucket 118: 30% bucket 101: 90% bucket 116: 40% bucket 109: 80% bucket 112: 60% bucket 96: 100% Sorting block of length 4269161 for bucket 96 (Using difference cover) bucket 99: 90% bucket 111: 70% bucket 105: 80% bucket 113: 60% bucket 121: 10% bucket 103: 100% Sorting block of length 3144997 for bucket 103 (Using difference cover) bucket 115: 50% bucket 119: 30% bucket 106: 80% bucket 117: 40% bucket 107: 80% bucket 102: 90% bucket 114: 60% bucket 104: 90% bucket 110: 70% bucket 122: 10% bucket 108: 90% bucket 100: 100% Sorting block of length 3939399 for bucket 100 (Using difference cover) bucket 120: 30% bucket 101: 100% Sorting block of length 3952878 for bucket 101 (Using difference cover) bucket 98: 100% Sorting block of length 2956533 for bucket 98 (Using difference cover) bucket 109: 90% bucket 116: 50% bucket 112: 70% bucket 111: 80% bucket 118: 40% bucket 113: 70% bucket 121: 20% bucket 105: 90% bucket 115: 60% bucket 99: 100% Sorting block of length 4124570 for bucket 99 (Using difference cover) bucket 119: 40% bucket 106: 90% bucket 117: 50% bucket 102: 100% Sorting block of length 1376210 for bucket 102 (Using difference cover) bucket 107: 90% bucket 110: 80% bucket 114: 70% bucket 122: 20% bucket 104: 100% Sorting block of length 4308805 for bucket 104 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4170629 for bucket 93 Sorting block time: 00:00:01 Returning block of 3144998 for bucket 103 bucket 108: 100% Sorting block of length 4158085 for bucket 108 (Using difference cover) bucket 120: 40% Getting block 123 of 208 Reserving size (4425267) for bucket 123 Calculating Z arrays for bucket 123 Entering block accumulator loop for bucket 123: Getting block 124 of 208 Reserving size (4425267) for bucket 124 Calculating Z arrays for bucket 124 Entering block accumulator loop for bucket 124: bucket 109: 100% Sorting block of length 2524076 for bucket 109 (Using difference cover) bucket 116: 60% bucket 111: 90% bucket 112: 80% bucket 121: 30% Sorting block time: 00:00:02 Returning block of 4269162 for bucket 96 Getting block 125 of 208 Reserving size (4425267) for bucket 125 Calculating Z arrays for bucket 125 Entering block accumulator loop for bucket 125: bucket 105: 100% Sorting block of length 4024278 for bucket 105 (Using difference cover) Sorting block time: 00:00:01 Returning block of 1376211 for bucket 102 bucket 113: 80% Getting block 126 of 208 Reserving size (4425267) for bucket 126 Calculating Z arrays for bucket 126 Entering block accumulator loop for bucket 126: bucket 118: 50% Sorting block time: 00:00:01 Returning block of 2956534 for bucket 98 Getting block 127 of 208 Reserving size (4425267) for bucket 127 Calculating Z arrays for bucket 127 Entering block accumulator loop for bucket 127: Sorting block time: 00:00:02 Returning block of 3939400 for bucket 100 Sorting block time: 00:00:01 Returning block of 3952879 for bucket 101 bucket 115: 70% Getting block 128 of 208 Reserving size (4425267) for bucket 128 Calculating Z arrays for bucket 128 Entering block accumulator loop for bucket 128: Getting block 129 of 208 Reserving size (4425267) for bucket 129 Calculating Z arrays for bucket 129 Entering block accumulator loop for bucket 129: Sorting block time: 00:00:01 Returning block of 2524077 for bucket 109 Getting block 130 of 208 Reserving size (4425267) for bucket 130 Calculating Z arrays for bucket 130 Entering block accumulator loop for bucket 130: bucket 106: 100% Sorting block of length 4024718 for bucket 106 (Using difference cover) Sorting block time: 00:00:02 Returning block of 4124571 for bucket 99 Sorting block time: 00:00:02 Returning block of 4158086 for bucket 108 Getting block 131 of 208 Reserving size (4425267) for bucket 131 Calculating Z arrays for bucket 131 Entering block accumulator loop for bucket 131: bucket 119: 50% Getting block 132 of 208 Reserving size (4425267) for bucket 132 Calculating Z arrays for bucket 132 Entering block accumulator loop for bucket 132: Sorting block time: 00:00:02 Returning block of 4308806 for bucket 104 Getting block 133 of 208 Reserving size (4425267) for bucket 133 Calculating Z arrays for bucket 133 Entering block accumulator loop for bucket 133: bucket 117: 60% bucket 107: 100% Sorting block of length 1525387 for bucket 107 (Using difference cover) Sorting block time: 00:00:01 Returning block of 4024279 for bucket 105 Getting block 134 of 208 Reserving size (4425267) for bucket 134 Calculating Z arrays for bucket 134 Entering block accumulator loop for bucket 134: bucket 110: 90% bucket 122: 30% bucket 114: 80% bucket 123: 10% Sorting block time: 00:00:01 Returning block of 1525388 for bucket 107 bucket 120: 50% Getting block 135 of 208 Reserving size (4425267) for bucket 135 Calculating Z arrays for bucket 135 Entering block accumulator loop for bucket 135: bucket 124: 10% Sorting block time: 00:00:02 Returning block of 4024719 for bucket 106 Getting block 136 of 208 Reserving size (4425267) for bucket 136 Calculating Z arrays for bucket 136 Entering block accumulator loop for bucket 136: bucket 116: 70% bucket 111: 100% Sorting block of length 2595498 for bucket 111 (Using difference cover) bucket 121: 40% bucket 112: 90% bucket 127: 10% bucket 113: 90% bucket 118: 60% bucket 115: 80% bucket 125: 10% bucket 126: 10% Sorting block time: 00:00:01 Returning block of 2595499 for bucket 111 Getting block 137 of 208 Reserving size (4425267) for bucket 137 Calculating Z arrays for bucket 137 Entering block accumulator loop for bucket 137: bucket 132: 10% bucket 119: 60% bucket 129: 10% bucket 128: 10% bucket 117: 70% bucket 130: 10% bucket 131: 10% bucket 133: 10% bucket 114: 90% bucket 120: 60% bucket 123: 20% bucket 110: 100% Sorting block of length 3227165 for bucket 110 (Using difference cover) bucket 122: 40% bucket 134: 10% bucket 121: 50% bucket 124: 20% bucket 135: 10% bucket 112: 100% Sorting block of length 3074380 for bucket 112 (Using difference cover) bucket 116: 80% bucket 127: 20% bucket 113: 100% Sorting block of length 2584102 for bucket 113 (Using difference cover) bucket 136: 10% bucket 118: 70% Sorting block time: 00:00:02 Returning block of 3227166 for bucket 110 bucket 115: 90% Getting block 138 of 208 Reserving size (4425267) for bucket 138 Calculating Z arrays for bucket 138 Entering block accumulator loop for bucket 138: Sorting block time: 00:00:01 Returning block of 3074381 for bucket 112 Getting block 139 of 208 Reserving size (4425267) for bucket 139 Calculating Z arrays for bucket 139 Entering block accumulator loop for bucket 139: bucket 137: 10% Sorting block time: 00:00:01 Returning block of 2584103 for bucket 113 Getting block 140 of 208 Reserving size (4425267) for bucket 140 Calculating Z arrays for bucket 140 Entering block accumulator loop for bucket 140: bucket 125: 20% bucket 126: 20% bucket 119: 70% bucket 132: 20% bucket 117: 80% bucket 120: 70% bucket 123: 30% bucket 129: 20% bucket 114: 100% Sorting block of length 3636439 for bucket 114 (Using difference cover) bucket 128: 20% bucket 130: 20% bucket 121: 60% bucket 131: 20% bucket 127: 30% bucket 116: 90% bucket 122: 50% bucket 133: 20% bucket 134: 20% bucket 124: 30% bucket 115: 100% Sorting block of length 1469768 for bucket 115 (Using difference cover) bucket 118: 80% bucket 135: 20% Sorting block time: 00:00:02 Returning block of 3636440 for bucket 114 Getting block 141 of 208 Reserving size (4425267) for bucket 141 Calculating Z arrays for bucket 141 Entering block accumulator loop for bucket 141: bucket 139: 10% bucket 137: 20% bucket 126: 30% bucket 136: 20% bucket 138: 10% Sorting block time: 00:00:00 Returning block of 1469769 for bucket 115 bucket 119: 80% bucket 132: 30% Getting block 142 of 208 Reserving size (4425267) for bucket 142 Calculating Z arrays for bucket 142 Entering block accumulator loop for bucket 142: bucket 117: 90% bucket 125: 30% bucket 123: 40% bucket 120: 80% bucket 140: 10% bucket 121: 70% bucket 127: 40% bucket 129: 30% bucket 116: 100% Sorting block of length 2972476 for bucket 116 (Using difference cover) bucket 128: 30% bucket 130: 30% bucket 131: 30% bucket 122: 60% bucket 124: 40% bucket 134: 30% bucket 133: 30% bucket 118: 90% bucket 141: 10% bucket 126: 40% bucket 139: 20% bucket 137: 30% bucket 135: 30% Sorting block time: 00:00:01 Returning block of 2972477 for bucket 116 Getting block 143 of 208 Reserving size (4425267) for bucket 143 Calculating Z arrays for bucket 143 Entering block accumulator loop for bucket 143: bucket 132: 40% bucket 123: 50% bucket 119: 90% bucket 142: 10% bucket 117: 100% Sorting block of length 4246196 for bucket 117 (Using difference cover) bucket 120: 90% bucket 136: 30% bucket 138: 20% bucket 121: 80% bucket 125: 40% bucket 127: 50% bucket 140: 20% bucket 129: 40% Sorting block time: 00:00:02 Returning block of 4246197 for bucket 117 bucket 126: 50% bucket 128: 40% bucket 122: 70% bucket 130: 40% bucket 131: 40% bucket 118: 100% Sorting block of length 3072840 for bucket 118 (Using difference cover) bucket 141: 20% bucket 139: 30% Getting block 144 of 208 Reserving size (4425267) for bucket 144 Calculating Z arrays for bucket 144 Entering block accumulator loop for bucket 144: bucket 124: 50% bucket 137: 40% bucket 134: 40% bucket 133: 40% bucket 123: 60% bucket 143: 10% bucket 132: 50% bucket 135: 40% bucket 120: 100% Sorting block of length 3863488 for bucket 120 (Using difference cover) bucket 119: 100% Sorting block of length 2146579 for bucket 119 (Using difference cover) bucket 142: 20% bucket 121: 90% bucket 127: 60% bucket 136: 40% bucket 125: 50% bucket 138: 30% bucket 140: 30% bucket 126: 60% bucket 129: 50% bucket 139: 40% bucket 122: 80% Sorting block time: 00:00:01 Returning block of 3072841 for bucket 118 bucket 128: 50% Sorting block time: 00:00:01 Returning block of 2146580 for bucket 119 bucket 137: 50% bucket 130: 50% bucket 124: 60% bucket 141: 30% bucket 131: 50% bucket 123: 70% Getting block 145 of 208 Reserving size (4425267) for bucket 145 Calculating Z arrays for bucket 145 Entering block accumulator loop for bucket 145: Getting block 146 of 208 Reserving size (4425267) for bucket 146 Calculating Z arrays for bucket 146 Entering block accumulator loop for bucket 146: bucket 134: 50% bucket 143: 20% bucket 133: 50% bucket 144: 10% bucket 132: 60% Sorting block time: 00:00:02 Returning block of 3863489 for bucket 120 bucket 135: 50% Getting block 147 of 208 Reserving size (4425267) for bucket 147 Calculating Z arrays for bucket 147 Entering block accumulator loop for bucket 147: bucket 121: 100% Sorting block of length 3077165 for bucket 121 (Using difference cover) bucket 127: 70% bucket 142: 30% bucket 136: 50% bucket 125: 60% bucket 138: 40% Sorting block time: 00:00:01 Returning block of 3077166 for bucket 121 Getting block 148 of 208 Reserving size (4425267) for bucket 148 Calculating Z arrays for bucket 148 Entering block accumulator loop for bucket 148: bucket 126: 70% bucket 140: 40% bucket 139: 50% bucket 123: 80% bucket 137: 60% bucket 129: 60% bucket 141: 40% bucket 122: 90% bucket 124: 70% bucket 146: 10% bucket 145: 10% bucket 128: 60% bucket 130: 60% bucket 143: 30% bucket 131: 60% bucket 132: 70% bucket 127: 80% bucket 134: 60% bucket 147: 10% bucket 133: 60% bucket 135: 60% bucket 144: 20% bucket 142: 40% bucket 125: 70% bucket 136: 60% bucket 138: 50% bucket 126: 80% bucket 148: 10% bucket 140: 50% bucket 139: 60% bucket 123: 90% bucket 137: 70% bucket 129: 70% bucket 124: 80% bucket 122: 100% Sorting block of length 3251215 for bucket 122 (Using difference cover) bucket 141: 50% bucket 146: 20% bucket 128: 70% bucket 130: 70% bucket 131: 70% bucket 145: 20% bucket 143: 40% bucket 134: 70% bucket 132: 80% bucket 127: 90% bucket 133: 70% bucket 147: 20% bucket 135: 70% bucket 125: 80% bucket 142: 50% bucket 136: 70% bucket 144: 30% bucket 126: 90% bucket 138: 60% bucket 148: 20% bucket 123: 100% Sorting block of length 3347130 for bucket 123 (Using difference cover) bucket 139: 70% bucket 140: 60% bucket 124: 90% bucket 137: 80% bucket 129: 80% bucket 141: 60% bucket 146: 30% bucket 130: 80% bucket 128: 80% bucket 134: 80% bucket 143: 50% bucket 132: 90% bucket 145: 30% bucket 127: 100% Sorting block of length 3661322 for bucket 127 (Using difference cover) bucket 131: 80% bucket 133: 80% bucket 135: 80% bucket 147: 30% bucket 125: 90% Sorting block time: 00:00:01 Returning block of 3251216 for bucket 122 bucket 136: 80% bucket 142: 60% bucket 126: 100% Sorting block of length 1561315 for bucket 126 (Using difference cover) bucket 138: 70% Getting block 149 of 208 Reserving size (4425267) for bucket 149 Calculating Z arrays for bucket 149 Entering block accumulator loop for bucket 149: bucket 144: 40% Sorting block time: 00:00:00 Returning block of 1561316 for bucket 126 Getting block 150 of 208 Reserving size (4425267) for bucket 150 Calculating Z arrays for bucket 150 Entering block accumulator loop for bucket 150: bucket 148: 30% Sorting block time: 00:00:01 Returning block of 3347131 for bucket 123 Getting block 151 of 208 Reserving size (4425267) for bucket 151 Calculating Z arrays for bucket 151 Entering block accumulator loop for bucket 151: bucket 139: 80% bucket 124: 100% Sorting block of length 3494274 for bucket 124 (Using difference cover) bucket 137: 90% bucket 140: 70% Sorting block time: 00:00:01 Returning block of 3661323 for bucket 127 Getting block 152 of 208 Reserving size (4425267) for bucket 152 Calculating Z arrays for bucket 152 Entering block accumulator loop for bucket 152: bucket 141: 70% bucket 129: 90% bucket 146: 40% bucket 143: 60% bucket 134: 90% bucket 132: 100% Sorting block of length 3332444 for bucket 132 (Using difference cover) bucket 130: 90% bucket 145: 40% bucket 128: 90% bucket 131: 90% bucket 147: 40% bucket 125: 100% Sorting block of length 4014338 for bucket 125 (Using difference cover) bucket 135: 90% bucket 133: 90% bucket 142: 70% bucket 136: 90% bucket 138: 80% bucket 149: 10% Sorting block time: 00:00:01 Returning block of 3494275 for bucket 124 bucket 150: 10% Getting block 153 of 208 Reserving size (4425267) for bucket 153 Calculating Z arrays for bucket 153 Entering block accumulator loop for bucket 153: bucket 148: 40% bucket 151: 10% bucket 137: 100% Sorting block of length 4354364 for bucket 137 (Using difference cover) bucket 139: 90% bucket 144: 50% bucket 140: 80% bucket 141: 80% bucket 152: 10% bucket 129: 100% Sorting block of length 2995723 for bucket 129 (Using difference cover) bucket 146: 50% bucket 143: 70% bucket 134: 100% Sorting block of length 382556 for bucket 134 (Using difference cover) bucket 130: 100% Sorting block of length 3636836 for bucket 130 (Using difference cover) bucket 145: 50% bucket 128: 100% Sorting block of length 4265522 for bucket 128 (Using difference cover) bucket 131: 100% Sorting block of length 1185588 for bucket 131 (Using difference cover) Sorting block time: 00:00:00 Returning block of 382557 for bucket 134 Getting block 154 of 208 Reserving size (4425267) for bucket 154 Calculating Z arrays for bucket 154 Entering block accumulator loop for bucket 154: bucket 147: 50% bucket 135: 100% Sorting block of length 4578633 for bucket 135 (Using difference cover) Sorting block time: 00:00:01 Returning block of 3332445 for bucket 132 bucket 142: 80% bucket 133: 100% Sorting block of length 3529136 for bucket 133 (Using difference cover) Getting block 155 of 208 Reserving size (4425267) for bucket 155 Calculating Z arrays for bucket 155 Entering block accumulator loop for bucket 155: bucket 136: 100% Sorting block of length 1045180 for bucket 136 (Using difference cover) bucket 138: 90% Sorting block time: 00:00:02 Returning block of 4014339 for bucket 125 bucket 149: 20% Getting block 156 of 208 Reserving size (4425267) for bucket 156 Calculating Z arrays for bucket 156 Entering block accumulator loop for bucket 156: bucket 150: 20% bucket 148: 50% bucket 153: 10% bucket 151: 20% Sorting block time: 00:00:01 Returning block of 1185589 for bucket 131 Getting block 157 of 208 Reserving size (4425267) for bucket 157 Calculating Z arrays for bucket 157 Entering block accumulator loop for bucket 157: Sorting block time: 00:00:01 Returning block of 1045181 for bucket 136 Getting block 158 of 208 Reserving size (4425267) for bucket 158 Calculating Z arrays for bucket 158 Entering block accumulator loop for bucket 158: bucket 140: 90% Sorting block time: 00:00:01 Returning block of 4354365 for bucket 137 bucket 139: 100% Sorting block of length 2181282 for bucket 139 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2995724 for bucket 129 Getting block 159 of 208 Reserving size (4425267) for bucket 159 Calculating Z arrays for bucket 159 Entering block accumulator loop for bucket 159: Getting block 160 of 208 Reserving size (4425267) for bucket 160 Calculating Z arrays for bucket 160 Entering block accumulator loop for bucket 160: bucket 141: 90% bucket 144: 60% bucket 152: 20% Sorting block time: 00:00:02 Returning block of 3636837 for bucket 130 bucket 146: 60% bucket 143: 80% Getting block 161 of 208 Reserving size (4425267) for bucket 161 Calculating Z arrays for bucket 161 Entering block accumulator loop for bucket 161: Sorting block time: 00:00:02 Returning block of 3529137 for bucket 133 Getting block 162 of 208 Reserving size (4425267) for bucket 162 Calculating Z arrays for bucket 162 Entering block accumulator loop for bucket 162: Sorting block time: 00:00:02 Returning block of 4578634 for bucket 135 Sorting block time: 00:00:02 Returning block of 4265523 for bucket 128 Getting block 163 of 208 Reserving size (4425267) for bucket 163 Calculating Z arrays for bucket 163 Entering block accumulator loop for bucket 163: Getting block 164 of 208 Reserving size (4425267) for bucket 164 Calculating Z arrays for bucket 164 Entering block accumulator loop for bucket 164: bucket 145: 60% Sorting block time: 00:00:01 Returning block of 2181283 for bucket 139 bucket 147: 60% Getting block 165 of 208 Reserving size (4425267) for bucket 165 Calculating Z arrays for bucket 165 Entering block accumulator loop for bucket 165: bucket 142: 90% bucket 154: 10% bucket 155: 10% bucket 138: 100% Sorting block of length 2394858 for bucket 138 (Using difference cover) bucket 150: 30% bucket 148: 60% bucket 151: 30% bucket 158: 10% bucket 156: 10% bucket 140: 100% Sorting block of length 3348956 for bucket 140 (Using difference cover) bucket 149: 30% bucket 159: 10% bucket 141: 100% Sorting block of length 3109336 for bucket 141 (Using difference cover) bucket 153: 20% bucket 157: 10% bucket 146: 70% bucket 143: 90% Sorting block time: 00:00:02 Returning block of 2394859 for bucket 138 Getting block 166 of 208 Reserving size (4425267) for bucket 166 Calculating Z arrays for bucket 166 Entering block accumulator loop for bucket 166: bucket 144: 70% bucket 160: 10% bucket 152: 30% bucket 145: 70% Sorting block time: 00:00:01 Returning block of 3348957 for bucket 140 Getting block 167 of 208 Reserving size (4425267) for bucket 167 Calculating Z arrays for bucket 167 Entering block accumulator loop for bucket 167: bucket 147: 70% bucket 162: 10% bucket 142: 100% Sorting block of length 3107081 for bucket 142 (Using difference cover) bucket 163: 10% bucket 161: 10% Sorting block time: 00:00:01 Returning block of 3109337 for bucket 141 bucket 164: 10% Getting block 168 of 208 Reserving size (4425267) for bucket 168 Calculating Z arrays for bucket 168 Entering block accumulator loop for bucket 168: bucket 155: 20% bucket 165: 10% bucket 150: 40% bucket 148: 70% bucket 154: 20% bucket 151: 40% Sorting block time: 00:00:01 Returning block of 3107082 for bucket 142 Getting block 169 of 208 Reserving size (4425267) for bucket 169 Calculating Z arrays for bucket 169 Entering block accumulator loop for bucket 169: bucket 158: 20% bucket 159: 20% bucket 146: 80% bucket 143: 100% Sorting block of length 3530524 for bucket 143 (Using difference cover) bucket 156: 20% bucket 149: 40% bucket 153: 30% bucket 167: 10% bucket 145: 80% bucket 157: 20% bucket 144: 80% bucket 147: 80% bucket 166: 10% bucket 168: 10% bucket 152: 40% bucket 160: 20% bucket 155: 30% bucket 162: 20% bucket 163: 20% bucket 164: 20% bucket 161: 20% Sorting block time: 00:00:02 Returning block of 3530525 for bucket 143 Getting block 170 of 208 Reserving size (4425267) for bucket 170 Calculating Z arrays for bucket 170 Entering block accumulator loop for bucket 170: bucket 150: 50% bucket 151: 50% bucket 148: 80% bucket 169: 10% bucket 165: 20% bucket 158: 30% bucket 159: 30% bucket 154: 30% bucket 146: 90% bucket 167: 20% bucket 145: 90% bucket 147: 90% bucket 168: 20% bucket 153: 40% bucket 156: 30% bucket 149: 50% bucket 155: 40% bucket 144: 90% bucket 166: 20% bucket 157: 30% bucket 152: 50% bucket 170: 10% bucket 160: 30% bucket 162: 30% bucket 163: 30% bucket 150: 60% bucket 169: 20% bucket 164: 30% bucket 151: 60% bucket 148: 90% bucket 161: 30% bucket 165: 30% bucket 158: 40% bucket 159: 40% bucket 154: 40% bucket 146: 100% Sorting block of length 1956107 for bucket 146 (Using difference cover) bucket 167: 30% bucket 168: 30% bucket 153: 50% bucket 147: 100% Sorting block of length 4400718 for bucket 147 (Using difference cover) bucket 145: 100% Sorting block of length 3911005 for bucket 145 (Using difference cover) bucket 156: 40% bucket 155: 50% bucket 166: 30% bucket 149: 60% bucket 152: 60% bucket 157: 40% bucket 162: 40% bucket 170: 20% bucket 163: 40% bucket 160: 40% bucket 164: 40% bucket 169: 30% bucket 150: 70% bucket 151: 70% bucket 144: 100% Sorting block of length 4306675 for bucket 144 (Using difference cover) bucket 148: 100% Sorting block of length 3536978 for bucket 148 (Using difference cover) bucket 161: 40% bucket 165: 40% bucket 158: 50% bucket 159: 50% bucket 154: 50% bucket 167: 40% Sorting block time: 00:00:01 Returning block of 1956108 for bucket 146 Getting block 171 of 208 Reserving size (4425267) for bucket 171 Calculating Z arrays for bucket 171 Entering block accumulator loop for bucket 171: bucket 168: 40% bucket 153: 60% bucket 156: 50% bucket 166: 40% bucket 155: 60% bucket 152: 70% bucket 162: 50% bucket 163: 50% bucket 157: 50% bucket 170: 30% bucket 149: 70% bucket 160: 50% bucket 169: 40% bucket 164: 50% bucket 151: 80% bucket 150: 80% bucket 161: 50% bucket 165: 50% bucket 158: 60% bucket 159: 60% bucket 154: 60% bucket 167: 50% bucket 168: 50% bucket 171: 10% bucket 153: 70% bucket 166: 50% bucket 156: 60% bucket 155: 70% bucket 162: 60% bucket 152: 80% bucket 163: 60% Sorting block time: 00:00:01 Returning block of 3536979 for bucket 148 bucket 170: 40% bucket 169: 50% bucket 164: 60% Sorting block time: 00:00:01 Returning block of 3911006 for bucket 145 bucket 157: 60% bucket 160: 60% bucket 149: 80% Getting block 172 of 208 Reserving size (4425267) for bucket 172 Calculating Z arrays for bucket 172 Entering block accumulator loop for bucket 172: bucket 151: 90% Sorting block time: 00:00:01 Returning block of 4400719 for bucket 147 bucket 150: 90% bucket 161: 60% Getting block 173 of 208 Reserving size (4425267) for bucket 173 Calculating Z arrays for bucket 173 Entering block accumulator loop for bucket 173: bucket 165: 60% Getting block 174 of 208 Reserving size (4425267) for bucket 174 Calculating Z arrays for bucket 174 Entering block accumulator loop for bucket 174: bucket 158: 70% bucket 154: 70% bucket 159: 70% Sorting block time: 00:00:02 Returning block of 4306676 for bucket 144 bucket 167: 60% Getting block 175 of 208 Reserving size (4425267) for bucket 175 Calculating Z arrays for bucket 175 Entering block accumulator loop for bucket 175: bucket 168: 60% bucket 171: 20% bucket 166: 60% bucket 153: 80% bucket 155: 80% bucket 156: 70% bucket 152: 90% bucket 162: 70% bucket 169: 60% bucket 170: 50% bucket 163: 70% bucket 151: 100% Sorting block of length 1088156 for bucket 151 (Using difference cover) bucket 172: 10% bucket 149: 90% bucket 164: 70% bucket 165: 70% bucket 160: 70% bucket 173: 10% bucket 157: 70% Sorting block time: 00:00:01 Returning block of 1088157 for bucket 151 Getting block 176 of 208 Reserving size (4425267) for bucket 176 Calculating Z arrays for bucket 176 Entering block accumulator loop for bucket 176: bucket 174: 10% bucket 161: 70% bucket 150: 100% Sorting block of length 3340958 for bucket 150 (Using difference cover) bucket 158: 80% bucket 159: 80% bucket 167: 70% bucket 154: 80% bucket 168: 70% bucket 171: 30% Sorting block time: 00:00:01 Returning block of 3340959 for bucket 150 Getting block 177 of 208 Reserving size (4425267) for bucket 177 Calculating Z arrays for bucket 177 Entering block accumulator loop for bucket 177: bucket 175: 10% bucket 166: 70% bucket 152: 100% Sorting block of length 909285 for bucket 152 (Using difference cover) bucket 169: 70% bucket 153: 90% bucket 170: 60% bucket 155: 90% bucket 156: 80% bucket 162: 80% bucket 165: 80% bucket 172: 20% bucket 149: 100% Sorting block of length 3462528 for bucket 149 (Using difference cover) bucket 163: 80% bucket 164: 80% bucket 176: 10% bucket 173: 20% bucket 174: 20% bucket 160: 80% bucket 157: 80% bucket 158: 90% bucket 161: 80% Sorting block time: 00:00:01 Returning block of 909286 for bucket 152 bucket 159: 90% Getting block 178 of 208 Reserving size (4425267) for bucket 178 Calculating Z arrays for bucket 178 Entering block accumulator loop for bucket 178: bucket 167: 80% bucket 168: 80% bucket 154: 90% bucket 171: 40% bucket 177: 10% bucket 166: 80% bucket 175: 20% bucket 169: 80% bucket 170: 70% bucket 153: 100% Sorting block of length 4301106 for bucket 153 (Using difference cover) bucket 155: 100% Sorting block of length 1388654 for bucket 155 (Using difference cover) bucket 156: 90% bucket 162: 90% bucket 165: 90% bucket 163: 90% bucket 172: 30% bucket 164: 90% bucket 176: 20% bucket 173: 30% bucket 174: 30% bucket 160: 90% bucket 157: 90% bucket 161: 90% bucket 158: 100% Sorting block of length 2758924 for bucket 158 (Using difference cover) bucket 167: 90% bucket 159: 100% Sorting block of length 2411501 for bucket 159 (Using difference cover) bucket 178: 10% bucket 168: 90% bucket 154: 100% Sorting block of length 3790912 for bucket 154 (Using difference cover) bucket 177: 20% bucket 166: 90% bucket 171: 50% bucket 169: 90% Sorting block time: 00:00:01 Returning block of 1388655 for bucket 155 bucket 170: 80% bucket 175: 30% Getting block 179 of 208 Reserving size (4425267) for bucket 179 Calculating Z arrays for bucket 179 Entering block accumulator loop for bucket 179: bucket 162: 100% Sorting block of length 1122672 for bucket 162 (Using difference cover) bucket 165: 100% Sorting block of length 2109485 for bucket 165 (Using difference cover) bucket 156: 100% Sorting block of length 3304539 for bucket 156 (Using difference cover) Sorting block time: 00:00:01 Returning block of 3462529 for bucket 149 bucket 163: 100% Sorting block of length 3936402 for bucket 163 (Using difference cover) bucket 172: 40% bucket 164: 100% Sorting block of length 4146856 for bucket 164 (Using difference cover) Getting block 180 of 208 Reserving size (4425267) for bucket 180 Calculating Z arrays for bucket 180 Entering block accumulator loop for bucket 180: bucket 176: 30% bucket 173: 40% bucket 174: 40% Sorting block time: 00:00:01 Returning block of 2411502 for bucket 159 Getting block 181 of 208 Reserving size (4425267) for bucket 181 Calculating Z arrays for bucket 181 Entering block accumulator loop for bucket 181: Sorting block time: 00:00:01 Returning block of 1122673 for bucket 162 Sorting block time: 00:00:01 Returning block of 2758925 for bucket 158 Getting block 182 of 208 Reserving size (4425267) for bucket 182 Calculating Z arrays for bucket 182 Entering block accumulator loop for bucket 182: bucket 160: 100% Sorting block of length 4100589 for bucket 160 (Using difference cover) Getting block 183 of 208 Reserving size (4425267) for bucket 183 Calculating Z arrays for bucket 183 Entering block accumulator loop for bucket 183: bucket 167: 100% Sorting block of length 2669311 for bucket 167 (Using difference cover) bucket 161: 100% Sorting block of length 4289202 for bucket 161 (Using difference cover) bucket 178: 20% bucket 157: 100% Sorting block of length 2000969 for bucket 157 (Using difference cover) bucket 168: 100% Sorting block of length 3529279 for bucket 168 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2109486 for bucket 165 Getting block 184 of 208 Reserving size (4425267) for bucket 184 Calculating Z arrays for bucket 184 Entering block accumulator loop for bucket 184: Sorting block time: 00:00:02 Returning block of 4301107 for bucket 153 Getting block 185 of 208 Reserving size (4425267) for bucket 185 Calculating Z arrays for bucket 185 Entering block accumulator loop for bucket 185: Sorting block time: 00:00:02 Returning block of 3790913 for bucket 154 Getting block 186 of 208 Reserving size (4425267) for bucket 186 Calculating Z arrays for bucket 186 Entering block accumulator loop for bucket 186: Sorting block time: 00:00:02 Returning block of 3304540 for bucket 156 Getting block 187 of 208 Reserving size (4425267) for bucket 187 Calculating Z arrays for bucket 187 Entering block accumulator loop for bucket 187: Sorting block time: 00:00:01 Returning block of 2000970 for bucket 157 Getting block 188 of 208 Reserving size (4425267) for bucket 188 Calculating Z arrays for bucket 188 Entering block accumulator loop for bucket 188: Sorting block time: 00:00:02 Returning block of 4146857 for bucket 164 Sorting block time: 00:00:02 Returning block of 3936403 for bucket 163 bucket 169: 100% Sorting block of length 3654241 for bucket 169 (Using difference cover) bucket 177: 30% bucket 171: 60% Getting block 189 of 208 Reserving size (4425267) for bucket 189 Calculating Z arrays for bucket 189 Entering block accumulator loop for bucket 189: Getting block 190 of 208 Reserving size (4425267) for bucket 190 Calculating Z arrays for bucket 190 Entering block accumulator loop for bucket 190: bucket 170: 90% bucket 166: 100% Sorting block of length 2352491 for bucket 166 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2669312 for bucket 167 Getting block 191 of 208 Reserving size (4425267) for bucket 191 Calculating Z arrays for bucket 191 Entering block accumulator loop for bucket 191: Sorting block time: 00:00:01 Returning block of 4100590 for bucket 160 Getting block 192 of 208 Reserving size (4425267) for bucket 192 Calculating Z arrays for bucket 192 Entering block accumulator loop for bucket 192: Sorting block time: 00:00:02 Returning block of 4289203 for bucket 161 bucket 179: 10% bucket 175: 40% bucket 172: 50% Getting block 193 of 208 Reserving size (4425267) for bucket 193 Calculating Z arrays for bucket 193 Entering block accumulator loop for bucket 193: bucket 176: 40% bucket 180: 10% bucket 174: 50% bucket 173: 50% bucket 181: 10% Sorting block time: 00:00:01 Returning block of 2352492 for bucket 166 Getting block 194 of 208 Reserving size (4425267) for bucket 194 Calculating Z arrays for bucket 194 Entering block accumulator loop for bucket 194: Sorting block time: 00:00:03 Returning block of 3529280 for bucket 168 Getting block 195 of 208 Reserving size (4425267) for bucket 195 Calculating Z arrays for bucket 195 Entering block accumulator loop for bucket 195: Sorting block time: 00:00:02 Returning block of 3654242 for bucket 169 bucket 178: 30% Getting block 196 of 208 Reserving size (4425267) for bucket 196 Calculating Z arrays for bucket 196 Entering block accumulator loop for bucket 196: bucket 184: 10% bucket 182: 10% bucket 183: 10% bucket 185: 10% bucket 186: 10% bucket 171: 70% bucket 187: 10% bucket 170: 100% Sorting block of length 2694394 for bucket 170 (Using difference cover) bucket 191: 10% bucket 188: 10% bucket 190: 10% bucket 179: 20% bucket 177: 40% bucket 176: 50% bucket 172: 60% bucket 192: 10% bucket 189: 10% bucket 180: 20% bucket 174: 60% bucket 181: 20% Sorting block time: 00:00:01 Returning block of 2694395 for bucket 170 bucket 173: 60% Getting block 197 of 208 Reserving size (4425267) for bucket 197 Calculating Z arrays for bucket 197 Entering block accumulator loop for bucket 197: bucket 193: 10% bucket 195: 10% bucket 175: 50% bucket 196: 10% bucket 178: 40% bucket 184: 20% bucket 194: 10% bucket 182: 20% bucket 191: 20% bucket 183: 20% bucket 171: 80% bucket 185: 20% bucket 186: 20% bucket 179: 30% bucket 187: 20% bucket 176: 60% bucket 190: 20% bucket 188: 20% bucket 172: 70% bucket 180: 30% bucket 177: 50% bucket 192: 20% bucket 197: 10% bucket 181: 30% bucket 195: 20% bucket 174: 70% bucket 196: 20% bucket 173: 70% bucket 189: 20% bucket 184: 30% bucket 178: 50% bucket 193: 20% bucket 175: 60% bucket 194: 20% bucket 191: 30% bucket 171: 90% bucket 179: 40% bucket 182: 30% bucket 183: 30% bucket 176: 70% bucket 185: 30% bucket 172: 80% bucket 180: 40% bucket 186: 30% bucket 197: 20% bucket 190: 30% bucket 195: 30% bucket 181: 40% bucket 196: 30% bucket 187: 30% bucket 174: 80% bucket 188: 30% bucket 184: 40% bucket 192: 30% bucket 173: 80% bucket 177: 60% bucket 178: 60% bucket 189: 30% bucket 193: 30% bucket 194: 30% bucket 175: 70% bucket 191: 40% bucket 179: 50% bucket 176: 80% bucket 182: 40% bucket 171: 100% Sorting block of length 3532989 for bucket 171 (Using difference cover) bucket 185: 40% bucket 183: 40% bucket 197: 30% bucket 190: 40% bucket 186: 40% bucket 180: 50% bucket 172: 90% bucket 196: 40% bucket 181: 50% bucket 187: 40% bucket 195: 40% bucket 174: 90% bucket 188: 40% bucket 192: 40% bucket 184: 50% bucket 177: 70% bucket 178: 70% bucket 173: 90% bucket 193: 40% bucket 189: 40% bucket 194: 40% bucket 175: 80% bucket 191: 50% bucket 179: 60% bucket 176: 90% bucket 190: 50% bucket 182: 50% bucket 197: 40% bucket 185: 50% bucket 186: 50% bucket 196: 50% bucket 183: 50% bucket 180: 60% bucket 172: 100% Sorting block of length 3679914 for bucket 172 (Using difference cover) bucket 187: 50% bucket 195: 50% bucket 181: 60% bucket 192: 50% bucket 188: 50% bucket 174: 100% Sorting block of length 3132217 for bucket 174 (Using difference cover) bucket 184: 60% bucket 177: 80% bucket 178: 80% bucket 173: 100% Sorting block of length 3117838 for bucket 173 (Using difference cover) bucket 193: 50% bucket 194: 50% bucket 189: 50% bucket 191: 60% bucket 175: 90% bucket 190: 60% Sorting block time: 00:00:02 Returning block of 3532990 for bucket 171 bucket 179: 70% bucket 176: 100% Sorting block of length 4412710 for bucket 176 (Using difference cover) bucket 197: 50% bucket 186: 60% bucket 196: 60% bucket 182: 60% bucket 185: 60% Getting block 198 of 208 Reserving size (4425267) for bucket 198 Calculating Z arrays for bucket 198 Entering block accumulator loop for bucket 198: bucket 183: 60% bucket 180: 70% bucket 195: 60% bucket 187: 60% bucket 192: 60% bucket 181: 70% bucket 184: 70% bucket 188: 60% Sorting block time: 00:00:02 Returning block of 3117839 for bucket 173 bucket 177: 90% Sorting block time: 00:00:02 Returning block of 3132218 for bucket 174 Getting block 199 of 208 Reserving size (4425267) for bucket 199 Calculating Z arrays for bucket 199 Entering block accumulator loop for bucket 199: bucket 178: 90% Getting block 200 of 208 Reserving size (4425267) for bucket 200 Calculating Z arrays for bucket 200 Entering block accumulator loop for bucket 200: bucket 193: 60% Sorting block time: 00:00:02 Returning block of 3679915 for bucket 172 bucket 194: 60% Getting block 201 of 208 Reserving size (4425267) for bucket 201 Calculating Z arrays for bucket 201 Entering block accumulator loop for bucket 201: bucket 189: 60% bucket 191: 70% bucket 175: 100% Sorting block of length 4121988 for bucket 175 (Using difference cover) bucket 197: 60% bucket 196: 70% Sorting block time: 00:00:02 Returning block of 4412711 for bucket 176 bucket 179: 80% Getting block 202 of 208 Reserving size (4425267) for bucket 202 Calculating Z arrays for bucket 202 Entering block accumulator loop for bucket 202: bucket 190: 70% bucket 195: 70% bucket 180: 80% bucket 181: 80% bucket 198: 10% bucket 186: 70% bucket 185: 70% bucket 182: 70% bucket 184: 80% bucket 192: 70% bucket 183: 70% bucket 187: 70% bucket 199: 10% bucket 200: 10% bucket 178: 100% Sorting block of length 4237561 for bucket 178 (Using difference cover) bucket 188: 70% bucket 177: 100% Sorting block of length 983959 for bucket 177 (Using difference cover) bucket 193: 70% bucket 201: 10% bucket 194: 70% bucket 191: 80% bucket 189: 70% Sorting block time: 00:00:02 Returning block of 4121989 for bucket 175 bucket 197: 70% bucket 196: 80% Sorting block time: 00:00:00 Returning block of 983960 for bucket 177 Getting block 203 of 208 Reserving size (4425267) for bucket 203 Calculating Z arrays for bucket 203 Entering block accumulator loop for bucket 203: Getting block 204 of 208 Reserving size (4425267) for bucket 204 Calculating Z arrays for bucket 204 Entering block accumulator loop for bucket 204: bucket 195: 80% bucket 179: 90% bucket 190: 80% bucket 202: 10% bucket 180: 90% bucket 198: 20% bucket 181: 90% bucket 186: 80% bucket 184: 90% bucket 185: 80% bucket 192: 80% bucket 182: 80% bucket 199: 20% bucket 200: 20% bucket 187: 80% bucket 183: 80% Sorting block time: 00:00:01 Returning block of 4237562 for bucket 178 Getting block 205 of 208 Reserving size (4425267) for bucket 205 Calculating Z arrays for bucket 205 Entering block accumulator loop for bucket 205: bucket 201: 20% bucket 188: 80% bucket 191: 90% bucket 193: 80% bucket 194: 80% bucket 197: 80% bucket 204: 10% bucket 195: 90% bucket 202: 20% bucket 189: 80% bucket 179: 100% Sorting block of length 2403448 for bucket 179 (Using difference cover) bucket 196: 90% bucket 203: 10% bucket 190: 90% bucket 198: 30% bucket 180: 100% Sorting block of length 2464832 for bucket 180 (Using difference cover) bucket 181: 100% Sorting block of length 3316386 for bucket 181 (Using difference cover) bucket 184: 100% Sorting block of length 3560300 for bucket 184 (Using difference cover) bucket 200: 30% bucket 199: 30% bucket 186: 90% bucket 192: 90% bucket 185: 90% bucket 182: 90% bucket 205: 10% bucket 187: 90% bucket 201: 30% bucket 183: 90% bucket 191: 100% Sorting block of length 4358177 for bucket 191 (Using difference cover) bucket 188: 90% bucket 193: 90% bucket 194: 90% bucket 197: 90% bucket 204: 20% bucket 195: 100% Sorting block of length 2521976 for bucket 195 (Using difference cover) bucket 202: 30% bucket 189: 90% bucket 203: 20% bucket 196: 100% Sorting block of length 2009843 for bucket 196 (Using difference cover) bucket 190: 100% Sorting block of length 2045350 for bucket 190 (Using difference cover) bucket 198: 40% bucket 200: 40% bucket 199: 40% bucket 192: 100% Sorting block of length 2625543 for bucket 192 (Using difference cover) bucket 186: 100% Sorting block of length 3652406 for bucket 186 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2464833 for bucket 180 bucket 185: 100% Sorting block of length 3597271 for bucket 185 (Using difference cover) bucket 205: 20% Sorting block time: 00:00:01 Returning block of 2403449 for bucket 179 Getting block 206 of 208 Reserving size (4425267) for bucket 206 Calculating Z arrays for bucket 206 Entering block accumulator loop for bucket 206: bucket 201: 40% bucket 182: 100% Sorting block of length 3461082 for bucket 182 (Using difference cover) bucket 187: 100% Sorting block of length 3818076 for bucket 187 (Using difference cover) Getting block 207 of 208 Reserving size (4425267) for bucket 207 Calculating Z arrays for bucket 207 Entering block accumulator loop for bucket 207: bucket 183: 100% Sorting block of length 2722360 for bucket 183 (Using difference cover) Sorting block time: 00:00:01 Returning block of 3316387 for bucket 181 Getting block 208 of 208 Reserving size (4425267) for bucket 208 Calculating Z arrays for bucket 208 Entering block accumulator loop for bucket 208: Sorting block time: 00:00:01 Returning block of 3560301 for bucket 184 bucket 194: 100% Sorting block of length 2364519 for bucket 194 (Using difference cover) bucket 188: 100% Sorting block of length 3351045 for bucket 188 (Using difference cover) bucket 193: 100% Sorting block of length 3582178 for bucket 193 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2045351 for bucket 190 Sorting block time: 00:00:01 Returning block of 2009844 for bucket 196 Sorting block time: 00:00:01 Returning block of 2521977 for bucket 195 bucket 202: 40% bucket 204: 30% bucket 197: 100% Sorting block of length 3968651 for bucket 197 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2625544 for bucket 192 Sorting block time: 00:00:01 Returning block of 2722361 for bucket 183 Sorting block time: 00:00:01 Returning block of 3597272 for bucket 185 Sorting block time: 00:00:02 Returning block of 4358178 for bucket 191 Sorting block time: 00:00:01 Returning block of 3461083 for bucket 182 bucket 198: 50% bucket 203: 30% Sorting block time: 00:00:01 Returning block of 2364520 for bucket 194 bucket 189: 100% Sorting block of length 3082658 for bucket 189 (Using difference cover) bucket 200: 50% Sorting block time: 00:00:01 Returning block of 3351046 for bucket 188 Sorting block time: 00:00:02 Returning block of 3652407 for bucket 186 bucket 199: 50% bucket 208: 10% Sorting block time: 00:00:02 Returning block of 3818077 for bucket 187 bucket 206: 10% bucket 205: 30% Sorting block time: 00:00:01 Returning block of 3582179 for bucket 193 bucket 207: 10% bucket 201: 50% Sorting block time: 00:00:02 Returning block of 3968652 for bucket 197 Sorting block time: 00:00:01 Returning block of 3082659 for bucket 189 bucket 204: 40% bucket 202: 50% bucket 208: 20% bucket 198: 60% bucket 200: 60% bucket 203: 40% bucket 199: 60% bucket 206: 20% bucket 205: 40% bucket 208: 30% bucket 207: 20% bucket 201: 60% bucket 204: 50% bucket 202: 60% bucket 198: 70% bucket 200: 70% bucket 199: 70% bucket 208: 40% bucket 203: 50% bucket 206: 30% bucket 205: 50% bucket 201: 70% bucket 207: 30% bucket 204: 60% bucket 208: 50% bucket 198: 80% bucket 202: 70% bucket 200: 80% bucket 199: 80% bucket 203: 60% bucket 206: 40% bucket 208: 60% bucket 201: 80% bucket 205: 60% bucket 204: 70% bucket 198: 90% bucket 207: 40% bucket 202: 80% bucket 200: 90% bucket 199: 90% bucket 203: 70% bucket 208: 70% bucket 206: 50% bucket 201: 90% bucket 205: 70% bucket 204: 80% bucket 198: 100% Sorting block of length 3049217 for bucket 198 (Using difference cover) bucket 202: 90% bucket 207: 50% bucket 208: 80% bucket 199: 100% Sorting block of length 3187561 for bucket 199 (Using difference cover) bucket 200: 100% Sorting block of length 2758373 for bucket 200 (Using difference cover) bucket 203: 80% bucket 206: 60% bucket 205: 80% bucket 204: 90% bucket 201: 100% Sorting block of length 2606402 for bucket 201 (Using difference cover) bucket 208: 90% bucket 202: 100% Sorting block of length 2405272 for bucket 202 (Using difference cover) bucket 207: 60% bucket 203: 90% bucket 206: 70% Sorting block time: 00:00:01 Returning block of 3049218 for bucket 198 bucket 208: 100% Sorting block of length 1459638 for bucket 208 (Using difference cover) bucket 205: 90% Sorting block time: 00:00:01 Returning block of 2758374 for bucket 200 bucket 204: 100% Sorting block of length 3526711 for bucket 204 (Using difference cover) Sorting block time: 00:00:01 Returning block of 3187562 for bucket 199 Sorting block time: 00:00:02 Returning block of 2606403 for bucket 201 Sorting block time: 00:00:01 Returning block of 1459639 for bucket 208 Sorting block time: 00:00:01 Returning block of 2405273 for bucket 202 bucket 207: 70% Sorting block time: 00:00:02 Returning block of 3526712 for bucket 204 bucket 206: 80% bucket 203: 100% Sorting block of length 2998727 for bucket 203 (Using difference cover) bucket 205: 100% Sorting block of length 2216951 for bucket 205 (Using difference cover) bucket 207: 80% bucket 206: 90% Sorting block time: 00:00:01 Returning block of 2998728 for bucket 203 Sorting block time: 00:00:00 Returning block of 2216952 for bucket 205 bucket 207: 90% bucket 206: 100% Sorting block of length 2518926 for bucket 206 (Using difference cover) bucket 207: 100% Sorting block of length 3212298 for bucket 207 (Using difference cover) Sorting block time: 00:00:01 Returning block of 2518927 for bucket 206 Sorting block time: 00:00:01 Returning block of 3212299 for bucket 207 Exited Ebwt loop fchr[A]: 0 fchr[C]: 330645804 fchr[G]: 463945382 fchr[T]: 463945382 fchr[$]: 660839850 Exiting Ebwt::buildToDisk() Returning from initFromVector Wrote 224523443 bytes to primary EBWT file: BS_GA.rev.1.bt2 Wrote 165209968 bytes to secondary EBWT file: BS_GA.rev.2.bt2 Re-opening _in1 and _in2 as input streams Returning from Ebwt constructor Headers: len: 660839850 bwtLen: 660839851 sz: 165209963 bwtSz: 165209963 lineRate: 6 offRate: 4 offMask: 0xfffffff0 ftabChars: 10 eftabLen: 20 eftabSz: 80 ftabLen: 1048577 ftabSz: 4194308 offsLen: 41302491 offsSz: 165209964 lineSz: 64 sideSz: 64 sideBwtSz: 48 sideBwtLen: 192 numSides: 3441875 numLines: 3441875 ebwtTotLen: 220280000 ebwtTotSz: 220280000 color: 0 reverse: 1 Total time for backward call to driver() for mirror index: 00:04:02 Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH01_06_S1_L001_R1_001_val_1.fq.gz to CH01_06_S1_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH01_06_S1_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH01_06_S1_L001_R2_001_val_2.fq.gz to CH01_06_S1_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH01_06_S1_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH01_06_S1_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_06_S1_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH01_06_S1_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_06_S1_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2392:1384_1:N:0:NTCACG/1 77 * 0 0 * * 0 0 GTAGTTGGTTTTGAAGATATGG JJFJJJJJJJJJJJJJFJFJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2392:1384_2:N:0:NTCACG/2 141 * 0 0 * * 0 0 CCATATCTTCAAAACCAACTAC JJJJJJJJJJ7JJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH01_06_S1_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_06_S1_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2392:1384_1:N:0:NTCACG/1 83 PGA_scaffold43__161_contigs__length_26349757_GA_converted 19964843 42 22M = 19964843 -22 CCATATCTTCAAAACCAACTAC JJJFJFJJJJJJJJJJJJJFJJ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:22 YS:i:0 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2392:1384_2:N:0:NTCACG/2 163 PGA_scaffold43__161_contigs__length_26349757_GA_converted 19964843 42 22M = 19964843 -22 CCATATCTTCAAAACCAACTAC JJJJJJJJJJ7JJJJJJJJJJJ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:22 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 28809 (72.02%) aligned concordantly 0 times 4719 (11.80%) aligned concordantly exactly 1 time 6472 (16.18%) aligned concordantly >1 times 27.98% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 28789 (71.97%) aligned concordantly 0 times 4730 (11.82%) aligned concordantly exactly 1 time 6481 (16.20%) aligned concordantly >1 times 28.03% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH01_06_S1_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_06_S1_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11258 Mapping efficiency: 28.1% Sequence pairs with no alignments under any condition: 24154 Sequence pairs did not map uniquely: 4588 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5622 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5636 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 335869 Total methylated C's in CpG context: 42201 Total methylated C's in CHG context: 1808 Total methylated C's in CHH context: 28990 Total methylated C's in Unknown context: 320 Total unmethylated C's in CpG context: 14292 Total unmethylated C's in CHG context: 66833 Total unmethylated C's in CHH context: 181745 Total unmethylated C's in Unknown context: 751 C methylated in CpG context: 74.7% C methylated in CHG context: 2.6% C methylated in CHH context: 13.8% C methylated in unknown context (CN or CHN): 29.9% Bismark completed in 0d 0h 0m 53s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH01_14_S2_L001_R1_001_val_1.fq.gz to CH01_14_S2_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH01_14_S2_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH01_14_S2_L001_R2_001_val_2.fq.gz to CH01_14_S2_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH01_14_S2_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH01_14_S2_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_14_S2_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH01_14_S2_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_14_S2_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:1834:1367_1:N:0:NGATGT/1 77 * 0 0 * * 0 0 GAGAGGGATGTGATAATGTTTATGATGAGTATTGTATATTAATTTTATTGTTTATATTAATATTTATTTTTTATAGTTTTT JJJFJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFJFJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJFJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:1834:1367_2:N:0:NGATGT/2 141 * 0 0 * * 0 0 CTAACAATCACAAATCTAACATATCAAAAAACCATTCATCAAAAACTCAACAATATAAAATATAAAAAACTATAAAAAAT JJFJJJFJFJJJJJ>> Writing bisulfite mapping results to CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 27307 (68.27%) aligned concordantly 0 times 4636 (11.59%) aligned concordantly exactly 1 time 8057 (20.14%) aligned concordantly >1 times 31.73% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 27562 (68.91%) aligned concordantly 0 times 4365 (10.91%) aligned concordantly exactly 1 time 8073 (20.18%) aligned concordantly >1 times 31.09% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH01_14_S2_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_14_S2_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11031 Mapping efficiency: 27.6% Sequence pairs with no alignments under any condition: 23040 Sequence pairs did not map uniquely: 5929 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5408 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5623 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 294198 Total methylated C's in CpG context: 30190 Total methylated C's in CHG context: 1500 Total methylated C's in CHH context: 35786 Total methylated C's in Unknown context: 427 Total unmethylated C's in CpG context: 14240 Total unmethylated C's in CHG context: 53223 Total unmethylated C's in CHH context: 159259 Total unmethylated C's in Unknown context: 902 C methylated in CpG context: 67.9% C methylated in CHG context: 2.7% C methylated in CHH context: 18.3% C methylated in unknown context (CN or CHN): 32.1% Bismark completed in 0d 0h 0m 53s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH01_22_S3_L001_R1_001_val_1.fq.gz to CH01_22_S3_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH01_22_S3_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH01_22_S3_L001_R2_001_val_2.fq.gz to CH01_22_S3_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH01_22_S3_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH01_22_S3_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_22_S3_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH01_22_S3_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_22_S3_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:4807:1384_1:N:0:NTAGGC/1 77 * 0 0 * * 0 0 GTGTGATGGTGATGTTTGAGTGGTAGTTGTAGTTTGAAATATTATATGGGAAGGTT JJJJJJJJJJJFJJJJJJJJJJJFFJJJJJJJJFJJFJJJJJJJJJJJJJ7FJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:4807:1384_2:N:0:NTAGGC/2 141 * 0 0 * * 0 0 AACCTTCCCATATAATATTTCAAACTACAACTACCACTCAAACATCACCATCACAC JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH01_22_S3_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_22_S3_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:4807:1384_1:N:0:NTAGGC/1 83 PGA_scaffold29__63_contigs__length_7458616_GA_converted 435067 42 56M = 435067 -56 AACCTTCCCATATAATATTTCAAACTACAACTACCACTCAAACATCACCATCACAC JJJJF7JJJJJJJJJJJJJFJJFJJJJJJJJFFJJJJJJJJJJJFJJJJJJJJJJJ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:56 YS:i:0 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:4807:1384_2:N:0:NTAGGC/2 163 PGA_scaffold29__63_contigs__length_7458616_GA_converted 435067 42 56M = 435067 -56 AACCTTCCCATATAATATTTCAAACTACAACTACCACTCAAACATCACCATCACAC JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:56 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 28319 (70.80%) aligned concordantly 0 times 4673 (11.68%) aligned concordantly exactly 1 time 7008 (17.52%) aligned concordantly >1 times 29.20% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 28238 (70.59%) aligned concordantly 0 times 4773 (11.93%) aligned concordantly exactly 1 time 6989 (17.47%) aligned concordantly >1 times 29.41% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH01_22_S3_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_22_S3_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11356 Mapping efficiency: 28.4% Sequence pairs with no alignments under any condition: 23683 Sequence pairs did not map uniquely: 4961 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5637 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5719 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 333983 Total methylated C's in CpG context: 34384 Total methylated C's in CHG context: 1468 Total methylated C's in CHH context: 30589 Total methylated C's in Unknown context: 380 Total unmethylated C's in CpG context: 16321 Total unmethylated C's in CHG context: 64313 Total unmethylated C's in CHH context: 186908 Total unmethylated C's in Unknown context: 799 C methylated in CpG context: 67.8% C methylated in CHG context: 2.2% C methylated in CHH context: 14.1% C methylated in unknown context (CN or CHN): 32.2% Bismark completed in 0d 0h 0m 50s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH01_38_S4_L001_R1_001_val_1.fq.gz to CH01_38_S4_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH01_38_S4_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH01_38_S4_L001_R2_001_val_2.fq.gz to CH01_38_S4_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH01_38_S4_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH01_38_S4_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_38_S4_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH01_38_S4_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_38_S4_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:3772:1384_1:N:0:NGACCA/1 77 * 0 0 * * 0 0 TTTTAAATTTAATGAATTTTATATAAAAGAGTATAAATGAATAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:3772:1384_2:N:0:NGACCA/2 141 * 0 0 * * 0 0 TTTTATTCATTTATACTCTTTTATATAAAATTCATTAAATTTAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH01_38_S4_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_38_S4_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:3772:1384_1:N:0:NGACCA/1 77 * 0 0 * * 0 0 TTTTAAATTTAATGAATTTTATATAAAAGAGTATAAATGAATAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:3772:1384_2:N:0:NGACCA/2 141 * 0 0 * * 0 0 TTTTATTCATTTATACTCTTTTATATAAAATTCATTAAATTTAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP >>> Writing bisulfite mapping results to CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 27831 (69.58%) aligned concordantly 0 times 4519 (11.30%) aligned concordantly exactly 1 time 7650 (19.12%) aligned concordantly >1 times 30.42% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 27890 (69.72%) aligned concordantly 0 times 4414 (11.04%) aligned concordantly exactly 1 time 7696 (19.24%) aligned concordantly >1 times 30.27% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH01_38_S4_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH01_38_S4_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11078 Mapping efficiency: 27.7% Sequence pairs with no alignments under any condition: 23464 Sequence pairs did not map uniquely: 5458 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5463 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5615 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 297178 Total methylated C's in CpG context: 29290 Total methylated C's in CHG context: 1571 Total methylated C's in CHH context: 39695 Total methylated C's in Unknown context: 517 Total unmethylated C's in CpG context: 13207 Total unmethylated C's in CHG context: 55011 Total unmethylated C's in CHH context: 158404 Total unmethylated C's in Unknown context: 854 C methylated in CpG context: 68.9% C methylated in CHG context: 2.8% C methylated in CHH context: 20.0% C methylated in unknown context (CN or CHN): 37.7% Bismark completed in 0d 0h 0m 54s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH03_04_S5_L001_R1_001_val_1.fq.gz to CH03_04_S5_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH03_04_S5_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH03_04_S5_L001_R2_001_val_2.fq.gz to CH03_04_S5_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH03_04_S5_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH03_04_S5_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_04_S5_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH03_04_S5_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_04_S5_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2676:1384_1:N:0:NCAGTG/1 99 PGA_scaffold45__51_contigs__length_13476971_CT_converted 7760606 0 50M = 7760606 -50 TTAGTTTTTGTGTTATGAGTGAATTTTATTAGTAATTTTGTGTGTAATTA JJAJAJJJJJJJJJJJJFJJJAAFJJJJJJJ>> Writing bisulfite mapping results to CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 26051 (65.13%) aligned concordantly 0 times 2858 (7.14%) aligned concordantly exactly 1 time 11091 (27.73%) aligned concordantly >1 times 34.87% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 25944 (64.86%) aligned concordantly 0 times 3007 (7.52%) aligned concordantly exactly 1 time 11049 (27.62%) aligned concordantly >1 times 35.14% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH03_04_S5_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_04_S5_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 8490 Mapping efficiency: 21.2% Sequence pairs with no alignments under any condition: 22932 Sequence pairs did not map uniquely: 8578 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 4274 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 4216 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 205762 Total methylated C's in CpG context: 2904 Total methylated C's in CHG context: 1192 Total methylated C's in CHH context: 69174 Total methylated C's in Unknown context: 663 Total unmethylated C's in CpG context: 20728 Total unmethylated C's in CHG context: 26444 Total unmethylated C's in CHH context: 85320 Total unmethylated C's in Unknown context: 742 C methylated in CpG context: 12.3% C methylated in CHG context: 4.3% C methylated in CHH context: 44.8% C methylated in unknown context (CN or CHN): 47.2% Bismark completed in 0d 0h 0m 57s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH03_15_S6_L001_R1_001_val_1.fq.gz to CH03_15_S6_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH03_15_S6_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH03_15_S6_L001_R2_001_val_2.fq.gz to CH03_15_S6_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH03_15_S6_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH03_15_S6_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_15_S6_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH03_15_S6_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_15_S6_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2280:1367_1:N:0:NCCAAT/1 77 * 0 0 * * 0 0 TGTTAATGGTTATGGAAGTTATTTATTTTTATTAAAAAATAATTTAATTTTTATTGTTTGTTTGGTTATGATGGGTTGAT JJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJFJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2280:1367_2:N:0:NCCAAT/2 141 * 0 0 * * 0 0 TAAAAATTTTAATCAACCCATCATAACCAAACAAACAATAAAAATTAAATTATTTTTTAATAAAAATAAATAACTTCCAT JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJFFJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH03_15_S6_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_15_S6_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2280:1367_1:N:0:NCCAAT/1 77 * 0 0 * * 0 0 TGTTAATGGTTATGGAAGTTATTTATTTTTATTAAAAAATAATTTAATTTTTATTGTTTGTTTGGTTATGATGGGTTGAT JJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJFJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2280:1367_2:N:0:NCCAAT/2 141 * 0 0 * * 0 0 TAAAAATTTTAATCAACCCATCATAACCAAACAAACAATAAAAATTAAATTATTTTTTAATAAAAATAAATAACTTCCAT JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJFFJJJ YT:Z:UP >>> Writing bisulfite mapping results to CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 30186 (75.47%) aligned concordantly 0 times 3148 (7.87%) aligned concordantly exactly 1 time 6666 (16.66%) aligned concordantly >1 times 24.54% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 30122 (75.31%) aligned concordantly 0 times 3229 (8.07%) aligned concordantly exactly 1 time 6649 (16.62%) aligned concordantly >1 times 24.70% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH03_15_S6_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_15_S6_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 7899 Mapping efficiency: 19.7% Sequence pairs with no alignments under any condition: 26920 Sequence pairs did not map uniquely: 5181 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 3960 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 3939 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 202738 Total methylated C's in CpG context: 5203 Total methylated C's in CHG context: 1037 Total methylated C's in CHH context: 36932 Total methylated C's in Unknown context: 364 Total unmethylated C's in CpG context: 22277 Total unmethylated C's in CHG context: 32441 Total unmethylated C's in CHH context: 104848 Total unmethylated C's in Unknown context: 581 C methylated in CpG context: 18.9% C methylated in CHG context: 3.1% C methylated in CHH context: 26.0% C methylated in unknown context (CN or CHN): 38.5% Bismark completed in 0d 0h 0m 48s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH03_33_S7_L001_R1_001_val_1.fq.gz to CH03_33_S7_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH03_33_S7_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH03_33_S7_L001_R2_001_val_2.fq.gz to CH03_33_S7_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH03_33_S7_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH03_33_S7_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_33_S7_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH03_33_S7_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_33_S7_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2605:1367_1:N:0:NAGATC/1 77 * 0 0 * * 0 0 ATATAATTTTTATTTGTTAATAATAATA JJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2605:1367_2:N:0:NAGATC/2 141 * 0 0 * * 0 0 TATTATTATTAACAAATAAAAATTATAT FJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH03_33_S7_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_33_S7_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2605:1367_1:N:0:NAGATC/1 77 * 0 0 * * 0 0 ATATAATTTTTATTTGTTAATAATAATA JJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2605:1367_2:N:0:NAGATC/2 141 * 0 0 * * 0 0 TATTATTATTAACAAATAAAAATTATAT FJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP >>> Writing bisulfite mapping results to CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 29848 (74.62%) aligned concordantly 0 times 4553 (11.38%) aligned concordantly exactly 1 time 5599 (14.00%) aligned concordantly >1 times 25.38% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 29851 (74.63%) aligned concordantly 0 times 4531 (11.33%) aligned concordantly exactly 1 time 5618 (14.04%) aligned concordantly >1 times 25.37% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH03_33_S7_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH03_33_S7_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 10814 Mapping efficiency: 27.0% Sequence pairs with no alignments under any condition: 25418 Sequence pairs did not map uniquely: 3768 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5390 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5424 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 335864 Total methylated C's in CpG context: 42232 Total methylated C's in CHG context: 1769 Total methylated C's in CHH context: 27001 Total methylated C's in Unknown context: 364 Total unmethylated C's in CpG context: 15307 Total unmethylated C's in CHG context: 67871 Total unmethylated C's in CHH context: 181684 Total unmethylated C's in Unknown context: 692 C methylated in CpG context: 73.4% C methylated in CHG context: 2.5% C methylated in CHH context: 12.9% C methylated in unknown context (CN or CHN): 34.5% Bismark completed in 0d 0h 0m 50s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH05_01_S8_L001_R1_001_val_1.fq.gz to CH05_01_S8_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH05_01_S8_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH05_01_S8_L001_R2_001_val_2.fq.gz to CH05_01_S8_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH05_01_S8_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH05_01_S8_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_01_S8_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH05_01_S8_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_01_S8_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:3112:1367_1:N:0:NCTTGA/1 77 * 0 0 * * 0 0 ATTATTATTTATTTATTTTAATTTTATTTTTTTTTAATTAATTTTTTTATTTATTATTTTTTTTTTTTTTTTATTTTTTTT JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJFJJJJFJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:3112:1367_2:N:0:NCTTGA/2 141 * 0 0 * * 0 0 ACATATATAAATATAAAACCCAACCAAAAAAAACTAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA FAJ-J-J-JJJ---FJJJ-7-FJA7JJJJJJJJ<-FJAJAJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH05_01_S8_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_01_S8_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:3112:1367_1:N:0:NCTTGA/1 77 * 0 0 * * 0 0 ATTATTATTTATTTATTTTAATTTTATTTTTTTTTAATTAATTTTTTTATTTATTATTTTTTTTTTTTTTTTATTTTTTTT JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJFJJJJFJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:3112:1367_2:N:0:NCTTGA/2 141 * 0 0 * * 0 0 ACATATATAAATATAAAACCCAACCAAAAAAAACTAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA FAJ-J-J-JJJ---FJJJ-7-FJA7JJJJJJJJ<-FJAJAJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP >>> Writing bisulfite mapping results to CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 25859 (64.65%) aligned concordantly 0 times 3630 (9.07%) aligned concordantly exactly 1 time 10511 (26.28%) aligned concordantly >1 times 35.35% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 25773 (64.43%) aligned concordantly 0 times 3640 (9.10%) aligned concordantly exactly 1 time 10587 (26.47%) aligned concordantly >1 times 35.57% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH05_01_S8_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_01_S8_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 10115 Mapping efficiency: 25.3% Sequence pairs with no alignments under any condition: 22135 Sequence pairs did not map uniquely: 7750 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5058 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5057 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 252320 Total methylated C's in CpG context: 15573 Total methylated C's in CHG context: 1636 Total methylated C's in CHH context: 67912 Total methylated C's in Unknown context: 655 Total unmethylated C's in CpG context: 13980 Total unmethylated C's in CHG context: 39452 Total unmethylated C's in CHH context: 113767 Total unmethylated C's in Unknown context: 756 C methylated in CpG context: 52.7% C methylated in CHG context: 4.0% C methylated in CHH context: 37.4% C methylated in unknown context (CN or CHN): 46.4% Bismark completed in 0d 0h 0m 52s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH05_06_S9_L001_R1_001_val_1.fq.gz to CH05_06_S9_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH05_06_S9_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH05_06_S9_L001_R2_001_val_2.fq.gz to CH05_06_S9_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH05_06_S9_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH05_06_S9_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_06_S9_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH05_06_S9_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_06_S9_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2402:1367_1:N:0:NATCAG/1 77 * 0 0 * * 0 0 TTGATTTGTGTAGATTTGTGATGTAATAATGTGATGTTATTTGTATTTTTTAGTTTAAGTTTTTTTTTTTTTTT JJJJJJJJFJJJJJJFJJJJJJJJJJJJJJJFF7FJFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2402:1367_2:N:0:NATCAG/2 141 * 0 0 * * 0 0 AAAAAAAAAAAAAAACTTAAACTAAAAAA JJJJJJJJJJJJJJJ<-->> Writing bisulfite mapping results to CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 30991 (77.48%) aligned concordantly 0 times 2837 (7.09%) aligned concordantly exactly 1 time 6172 (15.43%) aligned concordantly >1 times 22.52% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 30754 (76.89%) aligned concordantly 0 times 3067 (7.67%) aligned concordantly exactly 1 time 6179 (15.45%) aligned concordantly >1 times 23.11% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH05_06_S9_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_06_S9_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 7376 Mapping efficiency: 18.4% Sequence pairs with no alignments under any condition: 27780 Sequence pairs did not map uniquely: 4844 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 3752 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 3624 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 204803 Total methylated C's in CpG context: 1999 Total methylated C's in CHG context: 803 Total methylated C's in CHH context: 31268 Total methylated C's in Unknown context: 295 Total unmethylated C's in CpG context: 23855 Total unmethylated C's in CHG context: 31829 Total unmethylated C's in CHH context: 115049 Total unmethylated C's in Unknown context: 631 C methylated in CpG context: 7.7% C methylated in CHG context: 2.5% C methylated in CHH context: 21.4% C methylated in unknown context (CN or CHN): 31.9% Bismark completed in 0d 0h 0m 52s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH05_21_S10_L001_R1_001_val_1.fq.gz to CH05_21_S10_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH05_21_S10_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH05_21_S10_L001_R2_001_val_2.fq.gz to CH05_21_S10_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH05_21_S10_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH05_21_S10_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_21_S10_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH05_21_S10_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_21_S10_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2889:1367_1:N:0:NAGCTT/1 77 * 0 0 * * 0 0 AATGTTTTTTATTGATTATTAAATAATTTTATAATATTAAAATATGTATTATTATTATAGATAATAATTTTATAATATTAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2889:1367_2:N:0:NAGCTT/2 141 * 0 0 * * 0 0 ATAAATAATTTATATTATTTAATAATATTTATTTTATTTTATATTTAATTTAATATTTATAATAATAATACATATTT JJJJJJ7JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJ>> Writing bisulfite mapping results to CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 28198 (70.50%) aligned concordantly 0 times 4593 (11.48%) aligned concordantly exactly 1 time 7209 (18.02%) aligned concordantly >1 times 29.50% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 28245 (70.61%) aligned concordantly 0 times 4577 (11.44%) aligned concordantly exactly 1 time 7178 (17.95%) aligned concordantly >1 times 29.39% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH05_21_S10_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_21_S10_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11289 Mapping efficiency: 28.2% Sequence pairs with no alignments under any condition: 23680 Sequence pairs did not map uniquely: 5031 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5692 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5597 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 314760 Total methylated C's in CpG context: 28906 Total methylated C's in CHG context: 1995 Total methylated C's in CHH context: 46988 Total methylated C's in Unknown context: 583 Total unmethylated C's in CpG context: 15041 Total unmethylated C's in CHG context: 59843 Total unmethylated C's in CHH context: 161987 Total unmethylated C's in Unknown context: 747 C methylated in CpG context: 65.8% C methylated in CHG context: 3.2% C methylated in CHH context: 22.5% C methylated in unknown context (CN or CHN): 43.8% Bismark completed in 0d 0h 0m 51s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH05_24_S11_L001_R1_001_val_1.fq.gz to CH05_24_S11_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH05_24_S11_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH05_24_S11_L001_R2_001_val_2.fq.gz to CH05_24_S11_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH05_24_S11_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH05_24_S11_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_24_S11_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH05_24_S11_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_24_S11_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:1945:1384_1:N:0:NGCTAC/1 99 PGA_scaffold11__78_contigs__length_11409253_CT_converted 1558303 0 4M4I71M = 1558303 -75 ATTAATATTTTGTTAGTGTTTGTTGTTGTATTAATGAAGGTTGTTTTTTTATGTAGTTGGATTATTAGGTGGGTGGTAG JJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJFJJJJJJJJJ AS:i:-35 XN:i:0 XM:i:3 XO:i:1 XG:i:4 NM:i:7 MD:Z:1G0G0G71 YS:i:-35 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:1945:1384_2:N:0:NGCTAC/2 147 PGA_scaffold11__78_contigs__length_11409253_CT_converted 1558303 0 4M4I71M = 1558303 -75 ATTAATATTTTGTTAGTGTTTGTTGTTGTATTAATGAAGGTTGTTTTTTTATGTAGTTGGATTATTAGGTGGGTGGTAG JJJJJJJFJJFJJJJJ>> Writing bisulfite mapping results to CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 26863 (67.16%) aligned concordantly 0 times 4827 (12.07%) aligned concordantly exactly 1 time 8310 (20.77%) aligned concordantly >1 times 32.84% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 26808 (67.02%) aligned concordantly 0 times 4878 (12.20%) aligned concordantly exactly 1 time 8314 (20.79%) aligned concordantly >1 times 32.98% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH05_24_S11_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH05_24_S11_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 12012 Mapping efficiency: 30.0% Sequence pairs with no alignments under any condition: 21970 Sequence pairs did not map uniquely: 6018 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 6056 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5956 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 323750 Total methylated C's in CpG context: 37380 Total methylated C's in CHG context: 2071 Total methylated C's in CHH context: 45327 Total methylated C's in Unknown context: 514 Total unmethylated C's in CpG context: 14043 Total unmethylated C's in CHG context: 62328 Total unmethylated C's in CHH context: 162601 Total unmethylated C's in Unknown context: 839 C methylated in CpG context: 72.7% C methylated in CHG context: 3.2% C methylated in CHH context: 21.8% C methylated in unknown context (CN or CHN): 38.0% Bismark completed in 0d 0h 0m 52s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH07_06_S12_L001_R1_001_val_1.fq.gz to CH07_06_S12_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH07_06_S12_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH07_06_S12_L001_R2_001_val_2.fq.gz to CH07_06_S12_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH07_06_S12_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH07_06_S12_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_06_S12_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH07_06_S12_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_06_S12_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2077:1367_1:N:0:NGTCAA/1 77 * 0 0 * * 0 0 GATGTTGGGGAGATGGTGATTGAGTATGTTGGATAGGTGAGTGGTGAT JJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJAJJJJJJJJJJJJFJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2077:1367_2:N:0:NGTCAA/2 141 * 0 0 * * 0 0 ATCACCACTCACCTATCCAACATACTCAATCACCATCTCCCCAACATC JFJJJJJJJJJJJJJJJJJJJJJFJJJJJJJFJJFJJJJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH07_06_S12_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_06_S12_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2077:1367_1:N:0:NGTCAA/1 83 PGA_scaffold32__48_contigs__length_8091588_GA_converted 2907018 42 48M = 2907018 -48 ATCACCACTCACCTATCCAACATACTCAATCACCATCTCCCCAACATC JJJFJJJJJJJJJJJJAJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:48 YS:i:0 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2077:1367_2:N:0:NGTCAA/2 163 PGA_scaffold32__48_contigs__length_8091588_GA_converted 2907018 42 48M = 2907018 -48 ATCACCACTCACCTATCCAACATACTCAATCACCATCTCCCCAACATC JFJJJJJJJJJJJJJJJJJJJJJFJJJJJJJFJJFJJJJJJJJJJJJJ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:48 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 29075 (72.69%) aligned concordantly 0 times 4424 (11.06%) aligned concordantly exactly 1 time 6501 (16.25%) aligned concordantly >1 times 27.31% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 29013 (72.53%) aligned concordantly 0 times 4463 (11.16%) aligned concordantly exactly 1 time 6524 (16.31%) aligned concordantly >1 times 27.47% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH07_06_S12_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_06_S12_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 10796 Mapping efficiency: 27.0% Sequence pairs with no alignments under any condition: 24650 Sequence pairs did not map uniquely: 4554 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5434 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5362 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 311226 Total methylated C's in CpG context: 32278 Total methylated C's in CHG context: 1760 Total methylated C's in CHH context: 35296 Total methylated C's in Unknown context: 446 Total unmethylated C's in CpG context: 17065 Total unmethylated C's in CHG context: 58888 Total unmethylated C's in CHH context: 165939 Total unmethylated C's in Unknown context: 729 C methylated in CpG context: 65.4% C methylated in CHG context: 2.9% C methylated in CHH context: 17.5% C methylated in unknown context (CN or CHN): 38.0% Bismark completed in 0d 0h 0m 52s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH07_11_S13_L001_R1_001_val_1.fq.gz to CH07_11_S13_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH07_11_S13_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH07_11_S13_L001_R2_001_val_2.fq.gz to CH07_11_S13_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH07_11_S13_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH07_11_S13_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_11_S13_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH07_11_S13_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_11_S13_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2057:1367_1:N:0:NGTTCC/1 99 PGA_scaffold10__58_contigs__length_8083807_CT_converted 7923881 0 26M = 7923881 -26 TTTTATAATTTATATATATTATAATT JJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:4G21 YS:i:-6 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2057:1367_2:N:0:NGTTCC/2 147 PGA_scaffold10__58_contigs__length_8083807_CT_converted 7923881 0 26M = 7923881 -26 TTTTATAATTTATATATATTATAATT JFFJJJJJJJJJJFJJJJJJJJJJJJ AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:4G21 YS:i:-6 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH07_11_S13_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_11_S13_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2057:1367_1:N:0:NGTTCC/1 83 PGA_scaffold25__121_contigs__length_9021638_GA_converted 8608100 0 26M = 8608100 -26 AATTATAATATATATAAATTATAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:3A22 YS:i:-6 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2057:1367_2:N:0:NGTTCC/2 163 PGA_scaffold25__121_contigs__length_9021638_GA_converted 8608100 0 26M = 8608100 -26 AATTATAATATATATAAATTATAAAA JJJJJJJJJJJJFJJJJJJJJJJFFJ AS:i:-6 XS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:3A22 YS:i:-6 YT:Z:CP >>> Writing bisulfite mapping results to CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 31289 (78.22%) aligned concordantly 0 times 2995 (7.49%) aligned concordantly exactly 1 time 5716 (14.29%) aligned concordantly >1 times 21.78% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 31199 (78.00%) aligned concordantly 0 times 3105 (7.76%) aligned concordantly exactly 1 time 5696 (14.24%) aligned concordantly >1 times 22.00% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH07_11_S13_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_11_S13_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 7493 Mapping efficiency: 18.7% Sequence pairs with no alignments under any condition: 28174 Sequence pairs did not map uniquely: 4333 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 3766 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 3727 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 198465 Total methylated C's in CpG context: 2053 Total methylated C's in CHG context: 1047 Total methylated C's in CHH context: 29952 Total methylated C's in Unknown context: 367 Total unmethylated C's in CpG context: 22952 Total unmethylated C's in CHG context: 31718 Total unmethylated C's in CHH context: 110743 Total unmethylated C's in Unknown context: 662 C methylated in CpG context: 8.2% C methylated in CHG context: 3.2% C methylated in CHH context: 21.3% C methylated in unknown context (CN or CHN): 35.7% Bismark completed in 0d 0h 0m 47s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH07_24_S14_L001_R1_001_val_1.fq.gz to CH07_24_S14_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH07_24_S14_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH07_24_S14_L001_R2_001_val_2.fq.gz to CH07_24_S14_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH07_24_S14_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH07_24_S14_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_24_S14_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH07_24_S14_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_24_S14_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2544:1367_1:N:0:NTGTCA/1 99 PGA_scaffold43__161_contigs__length_26349757_CT_converted 10409520 1 81M = 10409568 129 GGGTTTAAAAAGAAGTGAAAAATATTTATGATTTTATAATATAATTTTTTGTTATATTTGATTGGTATTTATTTTATGAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:81 YS:i:0 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2544:1367_2:N:0:NTGTCA/2 147 PGA_scaffold43__161_contigs__length_26349757_CT_converted 10409568 1 81M = 10409520 -129 TTGTTATATTTGATTGGTATTTATTTTATGAAAAATAGTTATTTATTAAAATAATGATATTATTAAATAAATAATATTAGT JJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:81 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH07_24_S14_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_24_S14_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2544:1367_1:N:0:NTGTCA/1 83 PGA_scaffold3__77_contigs__length_22140449_GA_converted 2160101 31 81M = 2160053 -129 TTTCATAAAATAAATACCAATCAAATATAACAAAAAATTATATTATAAAATCATAAATATTTTTCACTTCTTTTTAAACCC JJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:81 YS:i:0 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2544:1367_2:N:0:NTGTCA/2 163 PGA_scaffold3__77_contigs__length_22140449_GA_converted 2160053 31 81M = 2160101 129 ACTAATATTATTTATTTAATAATATCATTATTTTAATAAATAACTATTTTTCATAAAATAAATACCAATCAAATATAACAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJ AS:i:0 XS:i:-24 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:81 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 29060 (72.65%) aligned concordantly 0 times 3502 (8.76%) aligned concordantly exactly 1 time 7438 (18.59%) aligned concordantly >1 times 27.35% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 29111 (72.78%) aligned concordantly 0 times 3436 (8.59%) aligned concordantly exactly 1 time 7453 (18.63%) aligned concordantly >1 times 27.22% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH07_24_S14_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH07_24_S14_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 8756 Mapping efficiency: 21.9% Sequence pairs with no alignments under any condition: 25507 Sequence pairs did not map uniquely: 5737 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 4329 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 4427 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 226614 Total methylated C's in CpG context: 1917 Total methylated C's in CHG context: 915 Total methylated C's in CHH context: 32202 Total methylated C's in Unknown context: 345 Total unmethylated C's in CpG context: 25011 Total unmethylated C's in CHG context: 34777 Total unmethylated C's in CHH context: 131792 Total unmethylated C's in Unknown context: 748 C methylated in CpG context: 7.1% C methylated in CHG context: 2.6% C methylated in CHH context: 19.6% C methylated in unknown context (CN or CHN): 31.6% Bismark completed in 0d 0h 0m 50s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH09_02_S15_L001_R1_001_val_1.fq.gz to CH09_02_S15_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH09_02_S15_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH09_02_S15_L001_R2_001_val_2.fq.gz to CH09_02_S15_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH09_02_S15_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH09_02_S15_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_02_S15_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH09_02_S15_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_02_S15_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2991:1367_1:N:0:NCGTCC/1 77 * 0 0 * * 0 0 TATGGATTGTTTAGTAATTTGATTTATGATTTTTTATTTATTAGTGGTTGAATAGTATTGGATTTAGATAGTAATTT JFJJJJJJJJJ<>> Writing bisulfite mapping results to CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 27133 (67.83%) aligned concordantly 0 times 4319 (10.80%) aligned concordantly exactly 1 time 8548 (21.37%) aligned concordantly >1 times 32.17% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 26998 (67.50%) aligned concordantly 0 times 4518 (11.29%) aligned concordantly exactly 1 time 8484 (21.21%) aligned concordantly >1 times 32.51% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH09_02_S15_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_02_S15_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11163 Mapping efficiency: 27.9% Sequence pairs with no alignments under any condition: 22746 Sequence pairs did not map uniquely: 6091 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5616 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5547 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 290333 Total methylated C's in CpG context: 28519 Total methylated C's in CHG context: 1987 Total methylated C's in CHH context: 48057 Total methylated C's in Unknown context: 629 Total unmethylated C's in CpG context: 13077 Total unmethylated C's in CHG context: 50612 Total unmethylated C's in CHH context: 148081 Total unmethylated C's in Unknown context: 822 C methylated in CpG context: 68.6% C methylated in CHG context: 3.8% C methylated in CHH context: 24.5% C methylated in unknown context (CN or CHN): 43.3% Bismark completed in 0d 0h 0m 52s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH09_13_S16_L001_R1_001_val_1.fq.gz to CH09_13_S16_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH09_13_S16_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH09_13_S16_L001_R2_001_val_2.fq.gz to CH09_13_S16_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH09_13_S16_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH09_13_S16_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_13_S16_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH09_13_S16_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_13_S16_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2301:1367_1:N:0:NTCCGC/1 77 * 0 0 * * 0 0 ATTAATTTAATTTAGTTATAAATTTTATAAATGTTTTTTTAATTTTTTTTTATTTGAGTTATTTTTTTTAAAAATAATTT JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJFJJJJJJJJFJJJJJJJJJJJJFJJJFFJJJJJJJJJJJJ YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2301:1367_2:N:0:NTCCGC/2 141 * 0 0 * * 0 0 TATATAATACATTATTTAAAAATTAATTTTATTTTTTAAATTATTTTTAAAAAAAATAACTCAAATAAAAAAAAATTAAAA JJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJFAJAAFFJJJJJJJJF<7AAAJ7AF>> Writing bisulfite mapping results to CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 27237 (68.09%) aligned concordantly 0 times 4786 (11.96%) aligned concordantly exactly 1 time 7977 (19.94%) aligned concordantly >1 times 31.91% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 27362 (68.41%) aligned concordantly 0 times 4645 (11.61%) aligned concordantly exactly 1 time 7993 (19.98%) aligned concordantly >1 times 31.59% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH09_13_S16_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_13_S16_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11782 Mapping efficiency: 29.5% Sequence pairs with no alignments under any condition: 22535 Sequence pairs did not map uniquely: 5683 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5960 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5822 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 346147 Total methylated C's in CpG context: 20296 Total methylated C's in CHG context: 1719 Total methylated C's in CHH context: 46212 Total methylated C's in Unknown context: 447 Total unmethylated C's in CpG context: 20238 Total unmethylated C's in CHG context: 58256 Total unmethylated C's in CHH context: 199426 Total unmethylated C's in Unknown context: 811 C methylated in CpG context: 50.1% C methylated in CHG context: 2.9% C methylated in CHH context: 18.8% C methylated in unknown context (CN or CHN): 35.5% Bismark completed in 0d 0h 0m 54s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH09_28_S17_L001_R1_001_val_1.fq.gz to CH09_28_S17_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH09_28_S17_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH09_28_S17_L001_R2_001_val_2.fq.gz to CH09_28_S17_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH09_28_S17_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH09_28_S17_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_28_S17_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH09_28_S17_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_28_S17_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2788:1367_1:N:0:NTGAAA/1 77 * 0 0 * * 0 0 AGAGTATTAAGGAAGAATAGATAGGAATAGTTTTATTGAATTTAATGAGGTATTAAGAGAGAGATATTGAATGTAAGGGAA JJJJJJJJJJJJJJJFJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAFJJJJJJJJJJJJJJJJJJJJFF YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2788:1367_2:N:0:NTGAAA/2 141 * 0 0 * * 0 0 CTCCTCCTCTTAAAATACAAACTTATACACTTCCCTTACATTCAATATCTCTCTCTTAATACCTCATTAAATTCAATAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CH09_28_S17_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_28_S17_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2788:1367_1:N:0:NTGAAA/1 77 * 0 0 * * 0 0 AGAGTATTAAGGAAGAATAGATAGGAATAGTTTTATTGAATTTAATGAGGTATTAAGAGAGAGATATTGAATGTAAGGGAA JJJJJJJJJJJJJJJFJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAFJJJJJJJJJJJJJJJJJJJJFF YT:Z:UP K00337:413:HKTCHBBXY:1:1101:2788:1367_2:N:0:NTGAAA/2 141 * 0 0 * * 0 0 CTCCTCCTCTTAAAATACAAACTTATACACTTCCCTTACATTCAATATCTCTCTCTTAATACCTCATTAAATTCAATAAAA JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ YT:Z:UP >>> Writing bisulfite mapping results to CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 30047 (75.12%) aligned concordantly 0 times 4308 (10.77%) aligned concordantly exactly 1 time 5645 (14.11%) aligned concordantly >1 times 24.88% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 30017 (75.04%) aligned concordantly 0 times 4397 (10.99%) aligned concordantly exactly 1 time 5586 (13.96%) aligned concordantly >1 times 24.96% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH09_28_S17_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH09_28_S17_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 10269 Mapping efficiency: 25.7% Sequence pairs with no alignments under any condition: 25783 Sequence pairs did not map uniquely: 3948 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5100 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5169 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 290834 Total methylated C's in CpG context: 30663 Total methylated C's in CHG context: 2113 Total methylated C's in CHH context: 30990 Total methylated C's in Unknown context: 414 Total unmethylated C's in CpG context: 13531 Total unmethylated C's in CHG context: 55701 Total unmethylated C's in CHH context: 157836 Total unmethylated C's in Unknown context: 745 C methylated in CpG context: 69.4% C methylated in CHG context: 3.7% C methylated in CHH context: 16.4% C methylated in unknown context (CN or CHN): 35.7% Bismark completed in 0d 0h 0m 49s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH10_01_S18_L001_R1_001_val_1.fq.gz to CH10_01_S18_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH10_01_S18_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH10_01_S18_L001_R2_001_val_2.fq.gz to CH10_01_S18_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH10_01_S18_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH10_01_S18_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_01_S18_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH10_01_S18_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_01_S18_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:3021:1384_1:N:0:NTTTCG/1 77 * 0 0 * * 0 0 TAGGTTATGGAGTATTGAGAGGGGATTTTGTATTGTTTTGTTATAGAGGAGTTTAAAAGGAGAGAATTTAGTTTAGTTATT JJJJJJJJJJJJJJJFJJJFFAJJF>> Writing bisulfite mapping results to CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 28662 (71.66%) aligned concordantly 0 times 4632 (11.58%) aligned concordantly exactly 1 time 6706 (16.77%) aligned concordantly >1 times 28.34% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 28535 (71.34%) aligned concordantly 0 times 4799 (12.00%) aligned concordantly exactly 1 time 6666 (16.66%) aligned concordantly >1 times 28.66% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH10_01_S18_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_01_S18_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11362 Mapping efficiency: 28.4% Sequence pairs with no alignments under any condition: 23986 Sequence pairs did not map uniquely: 4652 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5621 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5741 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 317292 Total methylated C's in CpG context: 34001 Total methylated C's in CHG context: 2197 Total methylated C's in CHH context: 35796 Total methylated C's in Unknown context: 501 Total unmethylated C's in CpG context: 13132 Total unmethylated C's in CHG context: 60406 Total unmethylated C's in CHH context: 171760 Total unmethylated C's in Unknown context: 752 C methylated in CpG context: 72.1% C methylated in CHG context: 3.5% C methylated in CHH context: 17.2% C methylated in unknown context (CN or CHN): 40.0% Bismark completed in 0d 0h 0m 50s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH10_08_S19_L001_R1_001_val_1.fq.gz to CH10_08_S19_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH10_08_S19_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH10_08_S19_L001_R2_001_val_2.fq.gz to CH10_08_S19_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH10_08_S19_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH10_08_S19_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_08_S19_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH10_08_S19_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_08_S19_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2179:1367_1:N:0:NGTACG/1 99 PGA_scaffold1__111_contigs__length_23635802_CT_converted 14218649 42 55M = 14218649 -55 TGAGGGGTTAGTTGTTGGTAGTAGATTGAGTTTTTGTAGGAGTTGGAGGTGTGTT JJFJJJJJJJJJJJJJF-FFJAAJJJJJFJFJJJJJFJAJFJAFJAJJFJ>> Writing bisulfite mapping results to CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 27186 (67.97%) aligned concordantly 0 times 3591 (8.98%) aligned concordantly exactly 1 time 9223 (23.06%) aligned concordantly >1 times 32.03% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 27096 (67.74%) aligned concordantly 0 times 3584 (8.96%) aligned concordantly exactly 1 time 9320 (23.30%) aligned concordantly >1 times 32.26% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH10_08_S19_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_08_S19_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 9724 Mapping efficiency: 24.3% Sequence pairs with no alignments under any condition: 23445 Sequence pairs did not map uniquely: 6831 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 4817 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 4907 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 242732 Total methylated C's in CpG context: 8800 Total methylated C's in CHG context: 1614 Total methylated C's in CHH context: 67924 Total methylated C's in Unknown context: 709 Total unmethylated C's in CpG context: 18574 Total unmethylated C's in CHG context: 35885 Total unmethylated C's in CHH context: 109935 Total unmethylated C's in Unknown context: 864 C methylated in CpG context: 32.1% C methylated in CHG context: 4.3% C methylated in CHH context: 38.2% C methylated in unknown context (CN or CHN): 45.1% Bismark completed in 0d 0h 0m 55s ==================== Bismark run complete ==================== Use of uninitialized value $path_to_bowtie in concatenation (.) or string at /gscratch/srlab/programs/Bismark-0.21.0/bismark line 6893. Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.1.0]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/gscratch/srlab/programs/samtools-1.4/bin/samtools' Reference genome folder provided is /gscratch/srlab/sr320/data/dumoar/scaff-genome/ (absolute path is '/gscratch/srlab/sr320/data/dumoar/scaff-genome/)' FastQ format assumed (by default) Processing sequences up to read no. 40000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 40 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/gscratch/scrubbed/sr320/031223-duscaff'): /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R1_001_val_1.fq.gz /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R2_001_val_2.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /gscratch/scrubbed/sr320/031223-duscaff Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R2_001_val_2.fq.gz Input files are in FastQ format Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R1_001_val_1.fq.gz Writing a C -> T converted version of the input file CH10_11_S20_L001_R1_001_val_1.fq.gz to CH10_11_S20_L001_R1_001_val_1.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file CH10_11_S20_L001_R1_001_val_1.fq.gz (40001 sequences in total) Processing reads up to sequence no. 40000 from /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R2_001_val_2.fq.gz Writing a G -> A converted version of the input file CH10_11_S20_L001_R2_001_val_2.fq.gz to CH10_11_S20_L001_R2_001_val_2.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file CH10_11_S20_L001_R2_001_val_2.fq.gz (40001 sequences in total) Input files are CH10_11_S20_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_11_S20_L001_R2_001_val_2.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /gscratch/srlab/sr320/data/dumoar/scaff-genome/ with the specified options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CH10_11_S20_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_11_S20_L001_R2_001_val_2.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 40 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: K00337:413:HKTCHBBXY:1:1101:2098:1367_1:N:0:NAGTGG/1 99 PGA_scaffold28__73_contigs__length_10794191_CT_converted 2481591 32 29M = 2481591 -29 ATAAATATTTTTTATATTTTTTTTTTTTT JJJJJJJJFJFJJJJJJJJJJJJJJJJJJ AS:i:0 XS:i:-6 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:29 YS:i:0 YT:Z:CP K00337:413:HKTCHBBXY:1:1101:2098:1367_2:N:0:NAGTGG/2 147 PGA_scaffold28__73_contigs__length_10794191_CT_converted 2481591 32 29M = 2481591 -29 ATAAATATTTTTTATATTTTTTTTTTTTT >> Writing bisulfite mapping results to CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.bam <<< Reading in the sequence files /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R1_001_val_1.fq.gz and /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R2_001_val_2.fq.gz 40000 reads; of these: 40000 (100.00%) were paired; of these: 27951 (69.88%) aligned concordantly 0 times 4515 (11.29%) aligned concordantly exactly 1 time 7534 (18.84%) aligned concordantly >1 times 30.12% overall alignment rate 40000 reads; of these: 40000 (100.00%) were paired; of these: 27958 (69.89%) aligned concordantly 0 times 4510 (11.28%) aligned concordantly exactly 1 time 7532 (18.83%) aligned concordantly >1 times 30.11% overall alignment rate Processed 40000 sequences in total Successfully deleted the temporary files CH10_11_S20_L001_R1_001_val_1.fq.gz_C_to_T.fastq and CH10_11_S20_L001_R2_001_val_2.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 40000 Number of paired-end alignments with a unique best hit: 11044 Mapping efficiency: 27.6% Sequence pairs with no alignments under any condition: 23555 Sequence pairs did not map uniquely: 5401 Sequence pairs which were discarded because genomic sequence could not be extracted: 0 Number of sequence pairs with unique best (first) alignment came from the bowtie output: CT/GA/CT: 5474 ((converted) top strand) GA/CT/CT: 0 (complementary to (converted) top strand) GA/CT/GA: 0 (complementary to (converted) bottom strand) CT/GA/GA: 5570 ((converted) bottom strand) Number of alignments to (merely theoretical) complementary strands being rejected in total: 0 Final Cytosine Methylation Report ================================= Total number of C's analysed: 293186 Total methylated C's in CpG context: 27219 Total methylated C's in CHG context: 1716 Total methylated C's in CHH context: 37884 Total methylated C's in Unknown context: 459 Total unmethylated C's in CpG context: 13657 Total unmethylated C's in CHG context: 53292 Total unmethylated C's in CHH context: 159418 Total unmethylated C's in Unknown context: 910 C methylated in CpG context: 66.6% C methylated in CHG context: 3.1% C methylated in CHH context: 19.2% C methylated in unknown context (CN or CHN): 33.5% Bismark completed in 0d 0h 0m 53s ==================== Bismark run complete ==================== Processing paired-end Bismark output file(s) (SAM format): CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.bam: 11258 Total number duplicated alignments removed: 2173 (19.30%) Duplicated alignments were found at: 1632 different position(s) Total count of deduplicated leftover sequences: 9085 (80.70% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.bam: 11031 Total number duplicated alignments removed: 2312 (20.96%) Duplicated alignments were found at: 1629 different position(s) Total count of deduplicated leftover sequences: 8719 (79.04% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.bam: 11356 Total number duplicated alignments removed: 2187 (19.26%) Duplicated alignments were found at: 1654 different position(s) Total count of deduplicated leftover sequences: 9169 (80.74% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.bam: 11078 Total number duplicated alignments removed: 2144 (19.35%) Duplicated alignments were found at: 1618 different position(s) Total count of deduplicated leftover sequences: 8934 (80.65% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.bam: 8490 Total number duplicated alignments removed: 1282 (15.10%) Duplicated alignments were found at: 977 different position(s) Total count of deduplicated leftover sequences: 7208 (84.90% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.bam: 7899 Total number duplicated alignments removed: 1565 (19.81%) Duplicated alignments were found at: 1153 different position(s) Total count of deduplicated leftover sequences: 6334 (80.19% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.bam: 10814 Total number duplicated alignments removed: 2284 (21.12%) Duplicated alignments were found at: 1635 different position(s) Total count of deduplicated leftover sequences: 8530 (78.88% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.bam: 10115 Total number duplicated alignments removed: 1625 (16.07%) Duplicated alignments were found at: 1255 different position(s) Total count of deduplicated leftover sequences: 8490 (83.93% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.bam: 7376 Total number duplicated alignments removed: 1447 (19.62%) Duplicated alignments were found at: 1041 different position(s) Total count of deduplicated leftover sequences: 5929 (80.38% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.bam: 11289 Total number duplicated alignments removed: 2618 (23.19%) Duplicated alignments were found at: 1823 different position(s) Total count of deduplicated leftover sequences: 8671 (76.81% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.bam: 12012 Total number duplicated alignments removed: 2292 (19.08%) Duplicated alignments were found at: 1697 different position(s) Total count of deduplicated leftover sequences: 9720 (80.92% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.bam: 10796 Total number duplicated alignments removed: 2203 (20.41%) Duplicated alignments were found at: 1623 different position(s) Total count of deduplicated leftover sequences: 8593 (79.59% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.bam: 7493 Total number duplicated alignments removed: 1580 (21.09%) Duplicated alignments were found at: 1144 different position(s) Total count of deduplicated leftover sequences: 5913 (78.91% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.bam: 8756 Total number duplicated alignments removed: 1613 (18.42%) Duplicated alignments were found at: 1199 different position(s) Total count of deduplicated leftover sequences: 7143 (81.58% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.bam: 11163 Total number duplicated alignments removed: 2134 (19.12%) Duplicated alignments were found at: 1573 different position(s) Total count of deduplicated leftover sequences: 9029 (80.88% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.bam: 11782 Total number duplicated alignments removed: 2242 (19.03%) Duplicated alignments were found at: 1643 different position(s) Total count of deduplicated leftover sequences: 9540 (80.97% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.bam: 10269 Total number duplicated alignments removed: 2026 (19.73%) Duplicated alignments were found at: 1532 different position(s) Total count of deduplicated leftover sequences: 8243 (80.27% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.bam: 11362 Total number duplicated alignments removed: 1978 (17.41%) Duplicated alignments were found at: 1515 different position(s) Total count of deduplicated leftover sequences: 9384 (82.59% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.bam: 9724 Total number duplicated alignments removed: 1605 (16.51%) Duplicated alignments were found at: 1198 different position(s) Total count of deduplicated leftover sequences: 8119 (83.49% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R2_001_val_2.fq.gz" Processing paired-end Bismark output file(s) (SAM format): CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.bam If there are several alignments to a single position in the genome the first alignment will be chosen. Since the input files are not in any way sorted this is a near-enough random selection of reads. Checking file >>CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.bam<< for signs of file truncation... Now testing Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.bam for positional sorting (which would be bad...) ...passed! Output file is: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Total number of alignments analysed in CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.bam: 11044 Total number duplicated alignments removed: 2119 (19.19%) Duplicated alignments were found at: 1605 different position(s) Total count of deduplicated leftover sequences: 8925 (80.81% of total) skipping header line: @HD VN:1.0 SO:unsorted skipping header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R2_001_val_2.fq.gz" *** Bismark methylation extractor version v0.21.0 *** Trying to determine the type of mapping from the SAM header line of file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Treating file(s) as paired-end data (as extracted from @PG line) Setting option '--no_overlap' since this is (normally) the right thing to do for paired-end data Core usage currently set to more than 20 threads. Let's see how this goes... (set value: 28) Summarising Bismark methylation extractor parameters: =============================================================== Bismark paired-end SAM format specified (default) Number of cores to be used: 28 Strand-specific outputs will be skipped. Separate output files for cytosines in CpG, CHG and CHH context will be generated Merge CHG and CHH context to non-CpG context specified Output will be written to the current directory ('/gscratch/scrubbed/sr320/031223-duscaff') Summarising bedGraph parameters: =============================================================== Generating additional output in bedGraph and coverage format bedGraph format: coverage format: Using a cutoff of 1 read(s) to report cytosine positions Reporting and sorting cytosine methylation information in CpG context only (default) The bedGraph UNIX sort command will use the following memory setting: '75%'. Temporary directory used for sorting is the output directory Checking file >>CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_06_S1_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 9085 lines in total Total number of methylation call strings processed: 18170 Final Cytosine Methylation Report ================================= Total number of C's analysed: 162164 Total methylated C's in CpG context: 20131 Total methylated C's in CHG context: 823 Total methylated C's in CHH context: 14365 Total C to T conversions in CpG context: 6928 Total C to T conversions in CHG context: 32018 Total C to T conversions in CHH context: 87899 C methylated in CpG context: 74.4% C methylated in non-CpG context: 11.2% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_14_S2_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8719 lines in total Total number of methylation call strings processed: 17438 Final Cytosine Methylation Report ================================= Total number of C's analysed: 131560 Total methylated C's in CpG context: 12936 Total methylated C's in CHG context: 710 Total methylated C's in CHH context: 17530 Total C to T conversions in CpG context: 6303 Total C to T conversions in CHG context: 23241 Total C to T conversions in CHH context: 70840 C methylated in CpG context: 67.2% C methylated in non-CpG context: 16.2% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_22_S3_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 9169 lines in total Total number of methylation call strings processed: 18338 Final Cytosine Methylation Report ================================= Total number of C's analysed: 162827 Total methylated C's in CpG context: 16540 Total methylated C's in CHG context: 723 Total methylated C's in CHH context: 15401 Total C to T conversions in CpG context: 7983 Total C to T conversions in CHG context: 30923 Total C to T conversions in CHH context: 91257 C methylated in CpG context: 67.4% C methylated in non-CpG context: 11.7% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH01_38_S4_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8934 lines in total Total number of methylation call strings processed: 17868 Final Cytosine Methylation Report ================================= Total number of C's analysed: 138213 Total methylated C's in CpG context: 13139 Total methylated C's in CHG context: 789 Total methylated C's in CHH context: 20754 Total C to T conversions in CpG context: 6233 Total C to T conversions in CHG context: 24844 Total C to T conversions in CHH context: 72454 C methylated in CpG context: 67.8% C methylated in non-CpG context: 18.1% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_04_S5_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 7208 lines in total Total number of methylation call strings processed: 14416 Final Cytosine Methylation Report ================================= Total number of C's analysed: 105791 Total methylated C's in CpG context: 1431 Total methylated C's in CHG context: 694 Total methylated C's in CHH context: 38411 Total C to T conversions in CpG context: 10128 Total C to T conversions in CHG context: 12668 Total C to T conversions in CHH context: 42459 C methylated in CpG context: 12.4% C methylated in non-CpG context: 41.5% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_15_S6_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 6334 lines in total Total number of methylation call strings processed: 12668 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101586 Total methylated C's in CpG context: 2571 Total methylated C's in CHG context: 519 Total methylated C's in CHH context: 19440 Total C to T conversions in CpG context: 10793 Total C to T conversions in CHG context: 15806 Total C to T conversions in CHH context: 52457 C methylated in CpG context: 19.2% C methylated in non-CpG context: 22.6% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH03_33_S7_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8530 lines in total Total number of methylation call strings processed: 17060 Final Cytosine Methylation Report ================================= Total number of C's analysed: 165221 Total methylated C's in CpG context: 20278 Total methylated C's in CHG context: 892 Total methylated C's in CHH context: 13515 Total C to T conversions in CpG context: 7562 Total C to T conversions in CHG context: 33023 Total C to T conversions in CHH context: 89951 C methylated in CpG context: 72.8% C methylated in non-CpG context: 10.5% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_01_S8_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8490 lines in total Total number of methylation call strings processed: 16980 Final Cytosine Methylation Report ================================= Total number of C's analysed: 125596 Total methylated C's in CpG context: 7293 Total methylated C's in CHG context: 860 Total methylated C's in CHH context: 36982 Total C to T conversions in CpG context: 6707 Total C to T conversions in CHG context: 18644 Total C to T conversions in CHH context: 55110 C methylated in CpG context: 52.1% C methylated in non-CpG context: 33.9% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_06_S9_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 5929 lines in total Total number of methylation call strings processed: 11858 Final Cytosine Methylation Report ================================= Total number of C's analysed: 112742 Total methylated C's in CpG context: 1080 Total methylated C's in CHG context: 468 Total methylated C's in CHH context: 17570 Total C to T conversions in CpG context: 12749 Total C to T conversions in CHG context: 17129 Total C to T conversions in CHH context: 63746 C methylated in CpG context: 7.8% C methylated in non-CpG context: 18.2% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_21_S10_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8671 lines in total Total number of methylation call strings processed: 17342 Final Cytosine Methylation Report ================================= Total number of C's analysed: 146989 Total methylated C's in CpG context: 12986 Total methylated C's in CHG context: 944 Total methylated C's in CHH context: 23967 Total C to T conversions in CpG context: 6947 Total C to T conversions in CHG context: 27154 Total C to T conversions in CHH context: 74991 C methylated in CpG context: 65.1% C methylated in non-CpG context: 19.6% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH05_24_S11_L001_R2_001_val_2.fq.gz" Now reading in Bismark result file CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 9720 lines in total Total number of methylation call strings processed: 19440 Final Cytosine Methylation Report ================================= Total number of C's analysed: 151222 Total methylated C's in CpG context: 16840 Total methylated C's in CHG context: 975 Total methylated C's in CHH context: 23385 Total C to T conversions in CpG context: 6428 Total C to T conversions in CHG context: 28243 Total C to T conversions in CHH context: 75351 C methylated in CpG context: 72.4% C methylated in non-CpG context: 19.0% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_06_S12_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8593 lines in total Total number of methylation call strings processed: 17186 Final Cytosine Methylation Report ================================= Total number of C's analysed: 152888 Total methylated C's in CpG context: 15568 Total methylated C's in CHG context: 893 Total methylated C's in CHH context: 17790 Total C to T conversions in CpG context: 8335 Total C to T conversions in CHG context: 28551 Total C to T conversions in CHH context: 81751 C methylated in CpG context: 65.1% C methylated in non-CpG context: 14.5% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_11_S13_L001_R2_001_val_2.fq.gz" Now reading in Bismark result file CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 5913 lines in total Total number of methylation call strings processed: 11826 Final Cytosine Methylation Report ================================= Total number of C's analysed: 101581 Total methylated C's in CpG context: 1015 Total methylated C's in CHG context: 527 Total methylated C's in CHH context: 15506 Total C to T conversions in CpG context: 11385 Total C to T conversions in CHG context: 16086 Total C to T conversions in CHH context: 57062 C methylated in CpG context: 8.2% C methylated in non-CpG context: 18.0% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH07_24_S14_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 7143 lines in total Total number of methylation call strings processed: 14286 Final Cytosine Methylation Report ================================= Total number of C's analysed: 116054 Total methylated C's in CpG context: 964 Total methylated C's in CHG context: 470 Total methylated C's in CHH context: 16364 Total C to T conversions in CpG context: 12213 Total C to T conversions in CHG context: 16944 Total C to T conversions in CHH context: 69099 C methylated in CpG context: 7.3% C methylated in non-CpG context: 16.4% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_02_S15_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 9029 lines in total Total number of methylation call strings processed: 18058 Final Cytosine Methylation Report ================================= Total number of C's analysed: 133299 Total methylated C's in CpG context: 12493 Total methylated C's in CHG context: 935 Total methylated C's in CHH context: 24787 Total C to T conversions in CpG context: 5914 Total C to T conversions in CHG context: 22095 Total C to T conversions in CHH context: 67075 C methylated in CpG context: 67.9% C methylated in non-CpG context: 22.4% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_13_S16_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 9540 lines in total Total number of methylation call strings processed: 19080 Final Cytosine Methylation Report ================================= Total number of C's analysed: 176643 Total methylated C's in CpG context: 9878 Total methylated C's in CHG context: 885 Total methylated C's in CHH context: 24028 Total C to T conversions in CpG context: 10065 Total C to T conversions in CHG context: 28745 Total C to T conversions in CHH context: 103042 C methylated in CpG context: 49.5% C methylated in non-CpG context: 15.9% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH09_28_S17_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8243 lines in total Total number of methylation call strings processed: 16486 Final Cytosine Methylation Report ================================= Total number of C's analysed: 142621 Total methylated C's in CpG context: 14465 Total methylated C's in CHG context: 1035 Total methylated C's in CHH context: 15301 Total C to T conversions in CpG context: 6591 Total C to T conversions in CHG context: 27191 Total C to T conversions in CHH context: 78038 C methylated in CpG context: 68.7% C methylated in non-CpG context: 13.4% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_01_S18_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 9384 lines in total Total number of methylation call strings processed: 18768 Final Cytosine Methylation Report ================================= Total number of C's analysed: 157160 Total methylated C's in CpG context: 16610 Total methylated C's in CHG context: 1053 Total methylated C's in CHH context: 17717 Total C to T conversions in CpG context: 6421 Total C to T conversions in CHG context: 29584 Total C to T conversions in CHH context: 85775 C methylated in CpG context: 72.1% C methylated in non-CpG context: 14.0% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_08_S19_L001_R2_001_val_2.fq.gz" Now reading in Bismark result file CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Merging individual splitting reports into overall report: 'CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8119 lines in total Total number of methylation call strings processed: 16238 Final Cytosine Methylation Report ================================= Total number of C's analysed: 124191 Total methylated C's in CpG context: 4261 Total methylated C's in CHG context: 830 Total methylated C's in CHH context: 37438 Total C to T conversions in CpG context: 9031 Total C to T conversions in CHG context: 17594 Total C to T conversions in CHH context: 55037 C methylated in CpG context: 32.1% C methylated in non-CpG context: 34.5% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Checking file >>CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam<< for signs of file truncation... Now testing Bismark result file >CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam< for positional sorting (which would be bad...) ...passed! Writing result file containing methylation information for C in CpG context to CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing result file containing methylation information for C in any other context to Non_CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. Now reading in Bismark result file CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bam Warning: unable to close filehandle IN properly. skipping SAM header line: @HD VN:1.0 SO:unsorted skipping SAM header line: @SQ SN:PGA_scaffold0__40_contigs__length_4818635 LN:4818635 skipping SAM header line: @SQ SN:PGA_scaffold1__111_contigs__length_23635802 LN:23635802 skipping SAM header line: @SQ SN:PGA_scaffold2__216_contigs__length_42616187 LN:42616187 skipping SAM header line: @SQ SN:PGA_scaffold3__77_contigs__length_22140449 LN:22140449 skipping SAM header line: @SQ SN:PGA_scaffold4__118_contigs__length_24133938 LN:24133938 skipping SAM header line: @SQ SN:PGA_scaffold5__54_contigs__length_17529967 LN:17529967 skipping SAM header line: @SQ SN:PGA_scaffold6__2_contigs__length_4500 LN:4500 skipping SAM header line: @SQ SN:PGA_scaffold7__77_contigs__length_16129408 LN:16129408 skipping SAM header line: @SQ SN:PGA_scaffold8__70_contigs__length_6254265 LN:6254265 skipping SAM header line: @SQ SN:PGA_scaffold9__2_contigs__length_6774 LN:6774 skipping SAM header line: @SQ SN:PGA_scaffold10__58_contigs__length_8083807 LN:8083807 skipping SAM header line: @SQ SN:PGA_scaffold11__78_contigs__length_11409253 LN:11409253 skipping SAM header line: @SQ SN:PGA_scaffold12__214_contigs__length_38711105 LN:38711105 skipping SAM header line: @SQ SN:PGA_scaffold13__56_contigs__length_10281103 LN:10281103 skipping SAM header line: @SQ SN:PGA_scaffold14__49_contigs__length_6382615 LN:6382615 skipping SAM header line: @SQ SN:PGA_scaffold15__74_contigs__length_14466968 LN:14466968 skipping SAM header line: @SQ SN:PGA_scaffold16__99_contigs__length_13714835 LN:13714835 skipping SAM header line: @SQ SN:PGA_scaffold17__171_contigs__length_27881435 LN:27881435 skipping SAM header line: @SQ SN:PGA_scaffold18__98_contigs__length_15388888 LN:15388888 skipping SAM header line: @SQ SN:PGA_scaffold19__65_contigs__length_13296201 LN:13296201 skipping SAM header line: @SQ SN:PGA_scaffold20__42_contigs__length_7444180 LN:7444180 skipping SAM header line: @SQ SN:PGA_scaffold21__67_contigs__length_16858916 LN:16858916 skipping SAM header line: @SQ SN:PGA_scaffold22__59_contigs__length_10008237 LN:10008237 skipping SAM header line: @SQ SN:PGA_scaffold23__65_contigs__length_9586800 LN:9586800 skipping SAM header line: @SQ SN:PGA_scaffold24__25_contigs__length_9615596 LN:9615596 skipping SAM header line: @SQ SN:PGA_scaffold25__121_contigs__length_9021638 LN:9021638 skipping SAM header line: @SQ SN:PGA_scaffold26__34_contigs__length_3174094 LN:3174094 skipping SAM header line: @SQ SN:PGA_scaffold27__24_contigs__length_4511419 LN:4511419 skipping SAM header line: @SQ SN:PGA_scaffold28__73_contigs__length_10794191 LN:10794191 skipping SAM header line: @SQ SN:PGA_scaffold29__63_contigs__length_7458616 LN:7458616 skipping SAM header line: @SQ SN:PGA_scaffold30__53_contigs__length_3533588 LN:3533588 skipping SAM header line: @SQ SN:PGA_scaffold31__35_contigs__length_1951197 LN:1951197 skipping SAM header line: @SQ SN:PGA_scaffold32__48_contigs__length_8091588 LN:8091588 skipping SAM header line: @SQ SN:PGA_scaffold33__68_contigs__length_5591008 LN:5591008 skipping SAM header line: @SQ SN:PGA_scaffold34__18_contigs__length_2048619 LN:2048619 skipping SAM header line: @SQ SN:PGA_scaffold35__36_contigs__length_7416912 LN:7416912 skipping SAM header line: @SQ SN:PGA_scaffold36__50_contigs__length_8312113 LN:8312113 skipping SAM header line: @SQ SN:PGA_scaffold37__114_contigs__length_22981779 LN:22981779 skipping SAM header line: @SQ SN:PGA_scaffold38__30_contigs__length_10707134 LN:10707134 skipping SAM header line: @SQ SN:PGA_scaffold39__82_contigs__length_19157343 LN:19157343 skipping SAM header line: @SQ SN:PGA_scaffold40__81_contigs__length_9975379 LN:9975379 skipping SAM header line: @SQ SN:PGA_scaffold41__67_contigs__length_15779270 LN:15779270 skipping SAM header line: @SQ SN:PGA_scaffold42__119_contigs__length_25812110 LN:25812110 skipping SAM header line: @SQ SN:PGA_scaffold43__161_contigs__length_26349757 LN:26349757 skipping SAM header line: @SQ SN:PGA_scaffold44__101_contigs__length_25971783 LN:25971783 skipping SAM header line: @SQ SN:PGA_scaffold45__51_contigs__length_13476971 LN:13476971 skipping SAM header line: @SQ SN:PGA_scaffold46__73_contigs__length_12693875 LN:12693875 skipping SAM header line: @SQ SN:PGA_scaffold47__164_contigs__length_21858264 LN:21858264 skipping SAM header line: @SQ SN:PGA_scaffold48__117_contigs__length_14149252 LN:14149252 skipping SAM header line: @PG ID:Bismark VN:v0.21.0 CL:"bismark --path_to_bowtie /gscratch/srlab/programs/bowtie2-2.3.4.1-linux-x86_64/ -genome /gscratch/srlab/sr320/data/dumoar/scaff-genome/ -u 40000 -p 40 -score_min L,0,-0.6 -1 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R1_001_val_1.fq.gz -2 /gscratch/srlab/lhs3/data/DuMOAR/mbdbs-trimmed/4416/CH10_11_S20_L001_R2_001_val_2.fq.gz" Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Finished processing child process. Exiting.. Now waiting for all child processes to complete Finished processing child process. Exiting.. Merging individual splitting reports into overall report: 'CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt' Merging from these individual files: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27 CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28 Processed 8925 lines in total Total number of methylation call strings processed: 17850 Final Cytosine Methylation Report ================================= Total number of C's analysed: 134944 Total methylated C's in CpG context: 12199 Total methylated C's in CHG context: 811 Total methylated C's in CHH context: 18879 Total C to T conversions in CpG context: 6169 Total C to T conversions in CHG context: 24026 Total C to T conversions in CHH context: 72860 C methylated in CpG context: 66.4% C methylated in non-CpG context: 16.9% Merging individual M-bias reports into overall M-bias statistics from these 28 individual files: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.1.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.2.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.3.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.4.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.5.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.6.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.7.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.8.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.9.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.10.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.11.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.12.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.13.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.14.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.15.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.16.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.17.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.18.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.19.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.20.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.21.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.22.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.23.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.24.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.25.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.26.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.27.mbias CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt.28.mbias Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Determining maximum read lengths for M-Bias plots Maximum read length of Read 1: 81 Maximum read length of Read 2: 81 Perl module GD::Graph::lines is not installed, skipping drawing M-bias plots (only writing out M-bias plot table) Deleting unused files ... CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Non_CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt contains data -> kept Using these input files: CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Non_CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Summary of parameters for bismark2bedGraph conversion: ====================================================== bedGraph output: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz output directory: >< remove whitespaces: no CX context: no (CpG context only, default) No-header selected: no Sorting method: Unix sort-based (smaller memory footprint, but slower) Sort buffer size: 75% Coverage threshold: 1 ============================================================================= Methylation information will now be written into a bedGraph and coverage file ============================================================================= Using the following files as Input: /gscratch/scrubbed/sr320/031223-duscaff/CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt Writing bedGraph to file: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bedGraph.gz Also writing out a coverage file including counts methylated and unmethylated residues to file: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz The genome of interest was specified to contain gazillions of chromosomes or scaffolds. Sorting everything in memory instead of writing out individual chromosome files ... Sorting input file CpG_context_CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.txt by positions (using -S of 75%) Finished BedGraph conversion ... Found 20 alignment reports in current directory. Now trying to figure out whether there are corresponding optional reports Writing Bismark HTML report to >> CH01_06_S1_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH01_06_S1_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH01_06_S1_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH01_14_S2_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH01_14_S2_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH01_14_S2_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH01_22_S3_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH01_22_S3_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH01_22_S3_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH01_38_S4_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH01_38_S4_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH01_38_S4_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH03_04_S5_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH03_04_S5_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH03_04_S5_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH03_15_S6_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH03_15_S6_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH03_15_S6_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH03_33_S7_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH03_33_S7_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH03_33_S7_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH05_01_S8_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH05_01_S8_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH05_01_S8_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH05_06_S9_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH05_06_S9_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH05_06_S9_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH05_21_S10_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH05_21_S10_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH05_21_S10_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH05_24_S11_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH05_24_S11_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH05_24_S11_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH07_06_S12_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH07_06_S12_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH07_06_S12_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH07_11_S13_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH07_11_S13_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH07_11_S13_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH07_24_S14_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH07_24_S14_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH07_24_S14_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH09_02_S15_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH09_02_S15_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH09_02_S15_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH09_13_S16_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH09_13_S16_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH09_13_S16_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH09_28_S17_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH09_28_S17_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH09_28_S17_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH10_01_S18_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH10_01_S18_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH10_01_S18_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH10_08_S19_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH10_08_S19_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH10_08_S19_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== Writing Bismark HTML report to >> CH10_11_S20_L001_R1_001_val_1_bismark_bt2_PE_report.html << ============================================================================================================== Using the following alignment report: > CH10_11_S20_L001_R1_001_val_1_bismark_bt2_PE_report.txt < Processing alignment report CH10_11_S20_L001_R1_001_val_1_bismark_bt2_PE_report.txt ... Complete Using the following deduplication report: > CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt < Processing deduplication report CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplication_report.txt ... Complete Using the following splitting report: > CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt < Processing splitting report CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated_splitting_report.txt ... Complete Using the following M-bias report: > CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt < Processing M-bias report CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.M-bias.txt ... Complete No nucleotide coverage report file specified, skipping this step ============================================================================================================== No Bismark/Bowtie2 single-end BAM files detected Found Bismark/Bowtie2 paired-end files No Bismark/HISAT2 single-end BAM files detected No Bismark/HISAT2 paired-end BAM files detected Generating Bismark summary report from 20 Bismark BAM file(s)... >> Reading from Bismark report: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_PE_report.txt >> Reading from Bismark report: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_PE_report.txt Wrote Bismark project summary to >> bismark_summary_report.html << [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... [bam_sort_core] merging from 0 files and 28 in-memory blocks... Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH01_06_S1_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH01_06_S1_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 449 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 555 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 1188 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 516 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 725 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 446 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 514 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 683 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 566 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 535 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 1058 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 355 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 675 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 382 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 347 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 693 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 598 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 625 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 671 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 517 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 455 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 550 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 260 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 644 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 368 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 478 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 399 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 1086 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 735 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 369 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 849 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 838 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 418 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 362 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 604 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 509 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 404 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 439 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 221 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 375 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 512 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 785 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 641 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 237 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 503 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 631 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 530 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH01_06_S1_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH01_06_S1_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH01_14_S2_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH01_14_S2_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 296 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 366 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 841 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 384 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 525 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 330 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 392 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 305 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 478 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 831 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 186 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 476 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 411 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 296 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 503 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 475 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 429 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 430 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 447 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 253 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 328 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 210 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 365 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 337 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 282 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 297 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 649 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 388 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 227 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 551 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 477 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 245 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 284 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 447 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 379 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 360 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 288 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 333 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 400 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 604 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 465 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 264 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 378 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 507 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 420 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH01_14_S2_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH01_14_S2_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH01_22_S3_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH01_22_S3_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 323 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 471 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 989 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 491 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 637 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 382 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 455 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 600 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 461 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 421 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 1050 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 261 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 683 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 317 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 361 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 526 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 572 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 452 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 512 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 472 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 348 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 355 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 244 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 624 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 489 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 447 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 357 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 1286 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 601 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 343 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 739 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 787 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 290 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 362 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 451 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 568 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 373 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 423 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 243 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 310 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 399 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 669 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 598 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 358 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 396 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 642 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 500 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH01_22_S3_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH01_22_S3_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH01_38_S4_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH01_38_S4_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 227 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 393 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 982 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 460 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 512 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 465 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 365 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 333 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 358 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 422 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 851 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 248 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 475 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 310 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 293 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 619 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 435 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 468 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 381 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 425 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 322 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 347 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 187 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 395 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 358 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 269 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 265 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 714 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 358 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 316 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 548 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 451 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 224 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 266 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 373 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 464 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 334 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 210 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 321 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 390 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 668 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 498 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 253 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 373 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 528 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 416 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH01_38_S4_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH01_38_S4_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH03_04_S5_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH03_04_S5_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 73 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 403 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 647 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 376 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 313 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 223 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 362 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 94 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 87 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 182 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 649 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 146 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 96 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 202 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 242 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 435 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 252 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 302 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 106 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 242 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 160 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 197 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 218 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 129 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 43 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 35 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 171 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 76 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 61 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 24 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 145 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 93 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 15 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 116 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 163 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 313 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 165 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 353 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 199 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 242 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 509 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 417 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 396 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 213 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 225 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 463 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 298 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH03_04_S5_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH03_04_S5_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH03_15_S6_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH03_15_S6_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 107 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 337 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 769 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 451 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 372 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 272 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 369 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 204 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 167 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 159 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 675 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 147 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 179 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 249 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 261 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 525 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 302 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 333 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 179 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 285 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 189 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 230 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 248 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 184 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 92 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 95 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 189 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 198 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 122 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 72 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 131 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 163 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 42 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 127 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 136 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 485 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 159 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 309 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 201 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 297 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 454 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 494 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 435 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 191 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 456 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 366 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH03_15_S6_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH03_15_S6_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH03_33_S7_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH03_33_S7_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 355 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 526 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 1227 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 698 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 774 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 507 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 434 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 571 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 398 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 538 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 1091 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 348 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 818 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 470 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 395 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 701 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 710 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 655 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 664 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 452 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 452 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 410 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 264 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 674 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 530 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 514 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 379 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 1035 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 531 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 517 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 861 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 763 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 413 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 510 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 602 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 544 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 291 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 443 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 326 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 319 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 522 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 851 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 678 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 255 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 505 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 792 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 567 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH03_33_S7_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH03_33_S7_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH05_01_S8_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH05_01_S8_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 199 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 363 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 731 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 467 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 427 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 300 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 275 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 153 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 203 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 333 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 687 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 194 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 255 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 234 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 225 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 456 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 360 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 372 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 205 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 316 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 218 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 181 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 204 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 141 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 237 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 168 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 308 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 145 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 102 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 233 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 289 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 123 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 206 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 251 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 380 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 192 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 322 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 162 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 227 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 419 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 463 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 419 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 281 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 272 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 427 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 346 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH05_01_S8_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH05_01_S8_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH05_06_S9_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH05_06_S9_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 54 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 444 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 718 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 440 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 477 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 467 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 154 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 102 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 210 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 699 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 144 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 150 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 262 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 305 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 589 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 285 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 321 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 123 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 295 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 148 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 200 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 168 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 84 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 78 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 160 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 97 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 81 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 42 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 169 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 63 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 14 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 129 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 88 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 429 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 249 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 422 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 228 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 226 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 596 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 531 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 503 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 306 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 181 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 432 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 416 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH05_06_S9_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH05_06_S9_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH05_21_S10_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH05_21_S10_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 275 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 475 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 967 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 350 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 642 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 411 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 442 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 414 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 320 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 443 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 842 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 233 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 436 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 376 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 307 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 488 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 516 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 470 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 417 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 460 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 352 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 325 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 249 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 371 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 241 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 348 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 217 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 650 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 323 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 244 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 501 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 488 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 212 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 267 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 432 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 536 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 304 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 404 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 242 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 286 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 459 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 659 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 501 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 328 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 412 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 599 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 393 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH05_21_S10_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH05_21_S10_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH05_24_S11_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH05_24_S11_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 321 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 464 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 1098 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 435 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 670 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 510 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 436 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 484 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 410 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 525 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 962 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 325 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 544 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 336 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 372 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 599 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 596 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 545 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 534 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 473 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 448 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 390 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 260 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 541 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 446 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 386 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 976 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 406 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 272 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 665 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 574 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 340 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 452 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 568 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 304 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 360 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 239 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 379 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 443 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 697 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 632 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 265 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 488 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 545 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 484 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH05_24_S11_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH05_24_S11_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH07_06_S12_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH07_06_S12_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 346 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 460 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 1019 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 525 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 704 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 335 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 437 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 484 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 353 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 466 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 1083 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 313 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 606 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 323 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 392 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 799 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 497 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 627 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 495 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 464 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 387 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 432 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 269 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 508 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 384 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 328 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 335 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 840 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 479 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 279 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 765 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 600 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 288 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 324 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 456 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 636 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 393 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 341 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 282 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 330 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 430 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 796 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 696 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 349 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 431 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 604 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 379 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH07_06_S12_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH07_06_S12_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH07_11_S13_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH07_11_S13_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 45 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 446 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 815 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 398 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 487 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 305 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 406 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 148 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 87 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 177 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 701 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 161 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 93 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 198 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 183 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 471 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 215 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 339 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 86 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 296 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 150 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 278 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 184 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 103 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 60 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 82 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 143 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 168 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 60 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 25 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 104 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 60 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 18 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 81 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 108 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 371 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 164 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 327 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 171 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 256 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 482 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 539 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 345 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 268 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 164 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 371 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 380 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH07_11_S13_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH07_11_S13_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH07_24_S14_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH07_24_S14_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 67 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 404 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 803 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 399 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 420 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 312 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 386 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 144 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 124 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 157 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 649 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 168 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 113 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 194 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 252 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 612 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 194 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 291 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 113 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 282 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 163 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 295 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 186 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 132 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 21 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 68 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 194 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 111 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 73 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 10 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 147 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 74 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 29 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 92 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 126 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 432 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 236 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 273 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 185 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 328 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 522 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 544 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 396 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 319 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 186 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 465 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 465 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH07_24_S14_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH07_24_S14_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH09_02_S15_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH09_02_S15_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 253 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 401 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 874 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 443 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 659 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 279 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 368 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 298 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 283 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 432 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 855 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 205 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 343 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 367 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 293 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 636 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 438 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 411 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 385 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 285 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 370 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 199 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 294 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 212 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 336 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 557 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 272 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 219 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 457 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 395 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 137 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 198 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 357 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 467 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 326 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 324 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 283 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 334 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 483 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 621 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 556 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 308 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 343 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 529 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 404 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH09_02_S15_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH09_02_S15_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH09_13_S16_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH09_13_S16_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 217 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 513 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 1060 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 418 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 604 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 452 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 506 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 223 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 316 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 386 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 979 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 221 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 293 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 366 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 392 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 681 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 529 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 497 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 292 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 495 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 329 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 349 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 273 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 246 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 185 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 241 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 253 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 489 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 214 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 192 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 458 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 384 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 158 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 287 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 321 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 572 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 314 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 446 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 340 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 492 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 690 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 592 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 346 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 422 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 563 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 535 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH09_13_S16_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH09_13_S16_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH09_28_S17_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH09_28_S17_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 265 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 345 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 946 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 397 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 533 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 356 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 379 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 437 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 380 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 435 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 933 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 287 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 568 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 284 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 366 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 493 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 504 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 590 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 407 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 343 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 237 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 222 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 489 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 375 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 352 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 317 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 1044 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 556 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 250 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 645 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 740 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 200 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 399 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 411 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 432 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 302 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 325 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 225 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 264 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 405 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 689 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 341 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 349 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 347 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 467 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 484 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH09_28_S17_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH09_28_S17_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH10_01_S18_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH10_01_S18_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 264 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 480 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 1123 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 606 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 664 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 451 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 357 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 436 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 385 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 566 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 992 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 295 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 560 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 299 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 349 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 558 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 634 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 532 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 408 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 488 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 383 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 390 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 270 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 461 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 381 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 397 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 350 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 891 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 427 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 252 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 633 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 645 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 260 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 316 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 509 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 515 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 353 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 409 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 306 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 373 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 411 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 784 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 585 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 293 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 425 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 581 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 509 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH10_01_S18_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH10_01_S18_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH10_08_S19_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH10_08_S19_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 95 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 330 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 712 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 354 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 489 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 348 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 334 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 147 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 149 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 247 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 640 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 231 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 191 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 261 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 223 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 523 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 294 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 329 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 177 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 343 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 186 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 307 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 150 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 152 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 54 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 156 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 190 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 216 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 95 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 78 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 181 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 161 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 81 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 114 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 217 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 396 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 218 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 360 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 178 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 256 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 441 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 520 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 461 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 258 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 216 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 438 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 363 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH10_08_S19_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH10_08_S19_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq! Summary of parameters for genome-wide cytosine report: ============================================================================== Coverage infile: CH10_11_S20_L001_R1_001_val_1_bismark_bt2_pe.deduplicated.bismark.cov.gz Output directory: >< Parent directory: >/gscratch/scrubbed/sr320/031223-duscaff/< Genome directory: >/gscratch/srlab/sr320/data/dumoar/scaff-genome/< CX context: no (CpG context only, default) Pooling CpG top/bottom strand evidence: yes Genome coordinates used: 0-based (user specified) GZIP compression: no Split by chromosome: no Now reading in and storing sequence information of the genome specified in: /gscratch/srlab/sr320/data/dumoar/scaff-genome/ chr PGA_scaffold0__40_contigs__length_4818635 (4818635 bp) chr PGA_scaffold1__111_contigs__length_23635802 (23635802 bp) chr PGA_scaffold2__216_contigs__length_42616187 (42616187 bp) chr PGA_scaffold3__77_contigs__length_22140449 (22140449 bp) chr PGA_scaffold4__118_contigs__length_24133938 (24133938 bp) chr PGA_scaffold5__54_contigs__length_17529967 (17529967 bp) chr PGA_scaffold6__2_contigs__length_4500 (4500 bp) chr PGA_scaffold7__77_contigs__length_16129408 (16129408 bp) chr PGA_scaffold8__70_contigs__length_6254265 (6254265 bp) chr PGA_scaffold9__2_contigs__length_6774 (6774 bp) chr PGA_scaffold10__58_contigs__length_8083807 (8083807 bp) chr PGA_scaffold11__78_contigs__length_11409253 (11409253 bp) chr PGA_scaffold12__214_contigs__length_38711105 (38711105 bp) chr PGA_scaffold13__56_contigs__length_10281103 (10281103 bp) chr PGA_scaffold14__49_contigs__length_6382615 (6382615 bp) chr PGA_scaffold15__74_contigs__length_14466968 (14466968 bp) chr PGA_scaffold16__99_contigs__length_13714835 (13714835 bp) chr PGA_scaffold17__171_contigs__length_27881435 (27881435 bp) chr PGA_scaffold18__98_contigs__length_15388888 (15388888 bp) chr PGA_scaffold19__65_contigs__length_13296201 (13296201 bp) chr PGA_scaffold20__42_contigs__length_7444180 (7444180 bp) chr PGA_scaffold21__67_contigs__length_16858916 (16858916 bp) chr PGA_scaffold22__59_contigs__length_10008237 (10008237 bp) chr PGA_scaffold23__65_contigs__length_9586800 (9586800 bp) chr PGA_scaffold24__25_contigs__length_9615596 (9615596 bp) chr PGA_scaffold25__121_contigs__length_9021638 (9021638 bp) chr PGA_scaffold26__34_contigs__length_3174094 (3174094 bp) chr PGA_scaffold27__24_contigs__length_4511419 (4511419 bp) chr PGA_scaffold28__73_contigs__length_10794191 (10794191 bp) chr PGA_scaffold29__63_contigs__length_7458616 (7458616 bp) chr PGA_scaffold30__53_contigs__length_3533588 (3533588 bp) chr PGA_scaffold31__35_contigs__length_1951197 (1951197 bp) chr PGA_scaffold32__48_contigs__length_8091588 (8091588 bp) chr PGA_scaffold33__68_contigs__length_5591008 (5591008 bp) chr PGA_scaffold34__18_contigs__length_2048619 (2048619 bp) chr PGA_scaffold35__36_contigs__length_7416912 (7416912 bp) chr PGA_scaffold36__50_contigs__length_8312113 (8312113 bp) chr PGA_scaffold37__114_contigs__length_22981779 (22981779 bp) chr PGA_scaffold38__30_contigs__length_10707134 (10707134 bp) chr PGA_scaffold39__82_contigs__length_19157343 (19157343 bp) chr PGA_scaffold40__81_contigs__length_9975379 (9975379 bp) chr PGA_scaffold41__67_contigs__length_15779270 (15779270 bp) chr PGA_scaffold42__119_contigs__length_25812110 (25812110 bp) chr PGA_scaffold43__161_contigs__length_26349757 (26349757 bp) chr PGA_scaffold44__101_contigs__length_25971783 (25971783 bp) chr PGA_scaffold45__51_contigs__length_13476971 (13476971 bp) chr PGA_scaffold46__73_contigs__length_12693875 (12693875 bp) chr PGA_scaffold47__164_contigs__length_21858264 (21858264 bp) chr PGA_scaffold48__117_contigs__length_14149252 (14149252 bp) Stored sequence information of 49 chromosomes/scaffolds in total ============================================================================== Methylation information will now be written into a genome-wide cytosine report ============================================================================== >>> Writing genome-wide cytosine report to: CH10_11_S20_L001.CpG_report.txt <<< Storing all covered cytosine positions for chromosome: PGA_scaffold0__40_contigs__length_4818635 Writing cytosine report for chromosome PGA_scaffold0__40_contigs__length_4818635 (stored 203 different covered positions) Writing cytosine report for chromosome PGA_scaffold1__111_contigs__length_23635802 (stored 471 different covered positions) Writing cytosine report for chromosome PGA_scaffold2__216_contigs__length_42616187 (stored 889 different covered positions) Writing cytosine report for chromosome PGA_scaffold3__77_contigs__length_22140449 (stored 446 different covered positions) Writing cytosine report for chromosome PGA_scaffold4__118_contigs__length_24133938 (stored 573 different covered positions) Writing cytosine report for chromosome PGA_scaffold5__54_contigs__length_17529967 (stored 449 different covered positions) Writing cytosine report for chromosome PGA_scaffold7__77_contigs__length_16129408 (stored 373 different covered positions) Writing cytosine report for chromosome PGA_scaffold8__70_contigs__length_6254265 (stored 265 different covered positions) Writing cytosine report for chromosome PGA_scaffold10__58_contigs__length_8083807 (stored 335 different covered positions) Writing cytosine report for chromosome PGA_scaffold11__78_contigs__length_11409253 (stored 429 different covered positions) Writing cytosine report for chromosome PGA_scaffold12__214_contigs__length_38711105 (stored 827 different covered positions) Writing cytosine report for chromosome PGA_scaffold13__56_contigs__length_10281103 (stored 267 different covered positions) Writing cytosine report for chromosome PGA_scaffold14__49_contigs__length_6382615 (stored 436 different covered positions) Writing cytosine report for chromosome PGA_scaffold15__74_contigs__length_14466968 (stored 268 different covered positions) Writing cytosine report for chromosome PGA_scaffold16__99_contigs__length_13714835 (stored 265 different covered positions) Writing cytosine report for chromosome PGA_scaffold17__171_contigs__length_27881435 (stored 554 different covered positions) Writing cytosine report for chromosome PGA_scaffold18__98_contigs__length_15388888 (stored 430 different covered positions) Writing cytosine report for chromosome PGA_scaffold19__65_contigs__length_13296201 (stored 450 different covered positions) Writing cytosine report for chromosome PGA_scaffold20__42_contigs__length_7444180 (stored 362 different covered positions) Writing cytosine report for chromosome PGA_scaffold21__67_contigs__length_16858916 (stored 407 different covered positions) Writing cytosine report for chromosome PGA_scaffold22__59_contigs__length_10008237 (stored 301 different covered positions) Writing cytosine report for chromosome PGA_scaffold23__65_contigs__length_9586800 (stored 298 different covered positions) Writing cytosine report for chromosome PGA_scaffold24__25_contigs__length_9615596 (stored 198 different covered positions) Writing cytosine report for chromosome PGA_scaffold25__121_contigs__length_9021638 (stored 331 different covered positions) Writing cytosine report for chromosome PGA_scaffold26__34_contigs__length_3174094 (stored 191 different covered positions) Writing cytosine report for chromosome PGA_scaffold27__24_contigs__length_4511419 (stored 231 different covered positions) Writing cytosine report for chromosome PGA_scaffold28__73_contigs__length_10794191 (stored 226 different covered positions) Writing cytosine report for chromosome PGA_scaffold29__63_contigs__length_7458616 (stored 544 different covered positions) Writing cytosine report for chromosome PGA_scaffold30__53_contigs__length_3533588 (stored 254 different covered positions) Writing cytosine report for chromosome PGA_scaffold31__35_contigs__length_1951197 (stored 245 different covered positions) Writing cytosine report for chromosome PGA_scaffold32__48_contigs__length_8091588 (stored 457 different covered positions) Writing cytosine report for chromosome PGA_scaffold33__68_contigs__length_5591008 (stored 350 different covered positions) Writing cytosine report for chromosome PGA_scaffold34__18_contigs__length_2048619 (stored 221 different covered positions) Writing cytosine report for chromosome PGA_scaffold35__36_contigs__length_7416912 (stored 224 different covered positions) Writing cytosine report for chromosome PGA_scaffold36__50_contigs__length_8312113 (stored 371 different covered positions) Writing cytosine report for chromosome PGA_scaffold37__114_contigs__length_22981779 (stored 485 different covered positions) Writing cytosine report for chromosome PGA_scaffold38__30_contigs__length_10707134 (stored 314 different covered positions) Writing cytosine report for chromosome PGA_scaffold39__82_contigs__length_19157343 (stored 391 different covered positions) Writing cytosine report for chromosome PGA_scaffold40__81_contigs__length_9975379 (stored 245 different covered positions) Writing cytosine report for chromosome PGA_scaffold41__67_contigs__length_15779270 (stored 290 different covered positions) Writing cytosine report for chromosome PGA_scaffold42__119_contigs__length_25812110 (stored 415 different covered positions) Writing cytosine report for chromosome PGA_scaffold43__161_contigs__length_26349757 (stored 599 different covered positions) Writing cytosine report for chromosome PGA_scaffold44__101_contigs__length_25971783 (stored 492 different covered positions) Writing cytosine report for chromosome PGA_scaffold45__51_contigs__length_13476971 (stored 311 different covered positions) Writing cytosine report for chromosome PGA_scaffold46__73_contigs__length_12693875 (stored 426 different covered positions) Writing cytosine report for chromosome PGA_scaffold47__164_contigs__length_21858264 (stored 479 different covered positions) Writing cytosine report for last chromosome PGA_scaffold48__117_contigs__length_14149252 (stored 429 different covered positions) Finished writing out cytosine report for covered chromosomes (processed 47 chromosomes/scaffolds in total) Now processing chromosomes that were not covered by any methylation calls in the coverage file... Writing cytosine report for not covered chromosome PGA_scaffold6__2_contigs__length_4500 Writing cytosine report for not covered chromosome PGA_scaffold9__2_contigs__length_6774 Finished writing out cytosine report (processed 49 chromosomes/scaffolds in total). coverage2cytosine processing complete. Now merging top and bottom strand CpGs into a single CG dinucleotide entity (reading from file >>CH10_11_S20_L001.CpG_report.txt<<, in output directory '') >>> Writing a new coverage file with top and bottom strand CpG methylation evidence merged to CH10_11_S20_L001.CpG_report.merged_CpG_evidence.cov <<< CpG merging complete. Good luck finding DMRs with bsseq!