Basic Statistics
| Measure | Value |
|---|---|
| Filename | POC-219-TP2_R2_001.fastp-trim.fq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 18547378 |
| Total Bases | 2.4 Gbp |
| Sequences flagged as poor quality | 0 |
| Sequence length | 15-135 |
| %GC | 40 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| ACGAAAATGAGCTATGACGCATGTTTAACTTTGAAATTTTTTTATTGATG | 23034 | 0.12419006071909464 | No Hit |
| ACATAAGTAATCTAAATATTATTTTTTTTTCTTAAGATTACCTTAGTCAA | 22942 | 0.1236940337335013 | No Hit |
| ACTAAAATTAGACGATTTTTTTCGAAATGGCGTTCAGTTGCTTATTGGTT | 18828 | 0.10151300092120838 | No Hit |