Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/srlab/programs/samtools-1.20/samtools' Reference genome folder provided is ../../data/ (absolute path is '/mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/data/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: early reports suggested that high values of -p to have diminishing returns. Please test different values using a small subset of data for your hardware setting. Each Bowtie 2 instance is going to be run with 10 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/output/04-Peve-bismark-array'): ../../data/03-Peve-bismark/POR-73-TP2_R1_001.fastp-trim.fq.gz ../../data/03-Peve-bismark/POR-73-TP2_R2_001.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/output/04-Peve-bismark-array/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/output/04-Peve-bismark-array Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../../data/03-Peve-bismark/POR-73-TP2_R1_001.fastp-trim.fq.gz and ../../data/03-Peve-bismark/POR-73-TP2_R2_001.fastp-trim.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../../data/03-Peve-bismark/POR-73-TP2_R1_001.fastp-trim.fq.gz Writing a C -> T converted version of the input file POR-73-TP2_R1_001.fastp-trim.fq.gz to POR-73-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file POR-73-TP2_R1_001.fastp-trim.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from ../../data/03-Peve-bismark/POR-73-TP2_R2_001.fastp-trim.fq.gz Writing a G -> A converted version of the input file POR-73-TP2_R2_001.fastp-trim.fq.gz to POR-73-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file POR-73-TP2_R2_001.fastp-trim.fq.gz (10001 sequences in total) Input files are POR-73-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-73-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/data/ with the specified options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from POR-73-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-73-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:7375:1084_1:N:0:TCGGATTC+TAGTTGCG/1 77 * 0 0 * * 0 0 GTAAATGTTGATGTAGAAATGGGTTATGGGTGGGGAGATTTGGGTGGTGATTAGTAGTGAGGTTGTTTGATAAGAGATTGAAATGTTGGGTTATGTTATTTTAGTTATGAAATATTATTGAATAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII YT:Z:UP LH00652:104:22KG7JLT4:7:1101:7375:1084_2:N:0:TCGGATTC+TAGTTGCG/2 141 * 0 0 * * 0 0 ACCTTTTCCCTTACTTCCACAAATAAAAAAAACAACCATAAAAACAAAATTAACAATCCCTAATTATTTTCAACAATCAATTAATTTTTCCCTTTATTTTTTTATATTAAACAATCCTAAATAATCCACCCTCTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIII9III-I9IIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from POR-73-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-73-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:7375:1084_1:N:0:TCGGATTC+TAGTTGCG/1 77 * 0 0 * * 0 0 GTAAATGTTGATGTAGAAATGGGTTATGGGTGGGGAGATTTGGGTGGTGATTAGTAGTGAGGTTGTTTGATAAGAGATTGAAATGTTGGGTTATGTTATTTTAGTTATGAAATATTATTGAATAAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIII YT:Z:UP LH00652:104:22KG7JLT4:7:1101:7375:1084_2:N:0:TCGGATTC+TAGTTGCG/2 141 * 0 0 * * 0 0 ACCTTTTCCCTTACTTCCACAAATAAAAAAAACAACCATAAAAACAAAATTAACAATCCCTAATTATTTTCAACAATCAATTAATTTTTCCCTTTATTTTTTTATATTAAACAATCCTAAATAATCCACCCTCTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIII9III-I9IIIIII YT:Z:UP >>> Writing bisulfite mapping results to POR-73-TP2_pe.bam <<< Reading in the sequence files ../../data/03-Peve-bismark/POR-73-TP2_R1_001.fastp-trim.fq.gz and ../../data/03-Peve-bismark/POR-73-TP2_R2_001.fastp-trim.fq.gz 1000010000 reads; of these: reads; of these: 1000010000 ( (100.00100.00%%) were paired; of these:) were paired; of these: 91159172 ( (91.1591.72%%) aligned concordantly 0 times) aligned concordantly 0 times 456437 ( (4.564.37%%) aligned concordantly exactly 1 time) aligned concordantly exactly 1 time 429391 ( (4.293.91%%) aligned concordantly >1 times) aligned concordantly >1 times 8.858.28%% overall alignment rate overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files POR-73-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-73-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 55491 Total methylated C's in CpG context: 692 Total methylated C's in CHG context: 17 Total methylated C's in CHH context: 98 Total methylated C's in Unknown context: 0 Total unmethylated C's in CpG context: 8261 Total unmethylated C's in CHG context: 9653 Total unmethylated C's in CHH context: 36770 Total unmethylated C's in Unknown context: 80 C methylated in CpG context: 7.7% C methylated in CHG context: 0.2% C methylated in CHH context: 0.3% C methylated in Unknown context (CN or CHN): 0.0% Bismark completed in 0d 0h 0m 15s ==================== Bismark run complete ====================