Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/srlab/programs/samtools-1.20/samtools' Reference genome folder provided is ../../data/ (absolute path is '/mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/data/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: early reports suggested that high values of -p to have diminishing returns. Please test different values using a small subset of data for your hardware setting. Each Bowtie 2 instance is going to be run with 10 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/output/04-Peve-bismark-array'): ../../data/03-Peve-bismark/POR-262-TP4_R1_001.fastp-trim.fq.gz ../../data/03-Peve-bismark/POR-262-TP4_R2_001.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/output/04-Peve-bismark-array/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/output/04-Peve-bismark-array Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../../data/03-Peve-bismark/POR-262-TP4_R1_001.fastp-trim.fq.gz and ../../data/03-Peve-bismark/POR-262-TP4_R2_001.fastp-trim.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../../data/03-Peve-bismark/POR-262-TP4_R1_001.fastp-trim.fq.gz Writing a C -> T converted version of the input file POR-262-TP4_R1_001.fastp-trim.fq.gz to POR-262-TP4_R1_001.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file POR-262-TP4_R1_001.fastp-trim.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from ../../data/03-Peve-bismark/POR-262-TP4_R2_001.fastp-trim.fq.gz Writing a G -> A converted version of the input file POR-262-TP4_R2_001.fastp-trim.fq.gz to POR-262-TP4_R2_001.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file POR-262-TP4_R2_001.fastp-trim.fq.gz (10001 sequences in total) Input files are POR-262-TP4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-262-TP4_R2_001.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/srlab/sr320/github/timeseries_molecular/E-Peve/data/ with the specified options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from POR-262-TP4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-262-TP4_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:15368:1084_1:N:0:GTCCTAAG+TGGTAGCT/1 77 * 0 0 * * 0 0 GTTTGTTTTTTTAATGAATATTTTGGGAAGTGAGATGATTTGTTATTTTTATGTAAGAGTGATTGTAAGAAGGAGAAAAGAAAGGTTTTTTTTATGTATGTGTAGAATATTATTTGTAGTTAAATATAAGTTAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIII YT:Z:UP LH00652:104:22KG7JLT4:7:1101:15368:1084_2:N:0:GTCCTAAG+TGGTAGCT/2 141 * 0 0 * * 0 0 TTTCATTAACCAAAAACCCACCACTTAACTTACAAATAACAACCTACAAATAATAATCTACTCATACACAATACCATCCAACTATATTTAACATAAATATTTAACTTATATTTAACTACAAATAATATTCTACAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from POR-262-TP4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-262-TP4_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 10 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:15368:1084_1:N:0:GTCCTAAG+TGGTAGCT/1 83 Porites_evermani_scaffold_17_GA_converted 839366 42 135M = 839267 -234 TTTAACTTATATTTAACTACAAATAATATTCTACACATACATAAAAAAAACCTTTCTTTTCTCCTTCTTACAATCACTCTTACATAAAAATAACAAATCATCTCACTTCCCAAAATATTCATTAAAAAAACAAAC IIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:135 YS:i:0 YT:Z:CP LH00652:104:22KG7JLT4:7:1101:15368:1084_2:N:0:GTCCTAAG+TGGTAGCT/2 163 Porites_evermani_scaffold_17_GA_converted 839267 42 135M = 839366 234 TTTCATTAACCAAAAACCCACCACTTAACTTACAAATAACAACCTACAAATAATAATCTACTCATACACAATACCATCCAACTATATTTAACATAAATATTTAACTTATATTTAACTACAAATAATATTCTACAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:135 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to POR-262-TP4_pe.bam <<< Reading in the sequence files ../../data/03-Peve-bismark/POR-262-TP4_R1_001.fastp-trim.fq.gz and ../../data/03-Peve-bismark/POR-262-TP4_R2_001.fastp-trim.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 5285 (52.85%) aligned concordantly 0 times 2507 (25.07%) aligned concordantly exactly 1 time 2208 (22.08%) aligned concordantly >1 times 47.15% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 5157 (51.57%) aligned concordantly 0 times 2598 (25.98%) aligned concordantly exactly 1 time 2245 (22.45%) aligned concordantly >1 times 48.43% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files POR-262-TP4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-262-TP4_R2_001.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 312083 Total methylated C's in CpG context: 4099 Total methylated C's in CHG context: 265 Total methylated C's in CHH context: 1098 Total methylated C's in Unknown context: 7 Total unmethylated C's in CpG context: 46114 Total unmethylated C's in CHG context: 54847 Total unmethylated C's in CHH context: 205660 Total unmethylated C's in Unknown context: 406 C methylated in CpG context: 8.2% C methylated in CHG context: 0.5% C methylated in CHH context: 0.5% C methylated in Unknown context (CN or CHN): 1.7% Bismark completed in 0d 0h 0m 16s ==================== Bismark run complete ====================