Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is ../data/ (absolute path is '/home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/E-Peve/data/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/E-Peve/code'): ../data/03-Peve-bismark/POR-72-TP2_R1_001.fastp-trim.fq.gz ../data/03-Peve-bismark/POR-72-TP2_R2_001.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/E-Peve/output/03-Peve-bismark/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/E-Peve/code Now reading in and storing sequence information of the genome specified in: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/E-Peve/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../data/03-Peve-bismark/POR-72-TP2_R1_001.fastp-trim.fq.gz and ../data/03-Peve-bismark/POR-72-TP2_R2_001.fastp-trim.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../data/03-Peve-bismark/POR-72-TP2_R1_001.fastp-trim.fq.gz Writing a C -> T converted version of the input file POR-72-TP2_R1_001.fastp-trim.fq.gz to POR-72-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file POR-72-TP2_R1_001.fastp-trim.fq.gz (10001 sequences in total) gzip: stdout: Broken pipe Processing reads up to sequence no. 10000 from ../data/03-Peve-bismark/POR-72-TP2_R2_001.fastp-trim.fq.gz Writing a G -> A converted version of the input file POR-72-TP2_R2_001.fastp-trim.fq.gz to POR-72-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file POR-72-TP2_R2_001.fastp-trim.fq.gz (10001 sequences in total) Input files are POR-72-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-72-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/E-Peve/data/ with the specified options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from POR-72-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-72-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:8362:1084_1:N:0:GAGAGTAC+TGCTTCCA/1 77 * 0 0 * * 0 0 TATTTGGTGAGATATTTTTTTATTAAAAGAATTGTTTATTGTTGTTATTTTTTTTGGAAAAAATTGATTTAAATAAAGTTTATTTTGTGATTTTTTTTAATTTGGTTTGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9II9IIIIIIIII YT:Z:UP LH00652:104:22KG7JLT4:7:1101:8362:1084_2:N:0:GAGAGTAC+TGCTTCCA/2 141 * 0 0 * * 0 0 AAAAATCACAAAATAAACTTTATTTAAATCAATTTTTTCCAAAAAAAATAACAACAATAAACAATTCTTTTAATAAAAAAATATCTCACCAAATAATAATCACTAAAAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from POR-72-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-72-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:8362:1084_1:N:0:GAGAGTAC+TGCTTCCA/1 83 Porites_evermani_scaffold_429_GA_converted 122579 37 110M = 122594 125 ACAAACCAAATTAAAAAAAATCACAAAATAAACTTTATTTAAATCAATTTTTTCCAAAAAAAATAACAACAATAAACAATTCTTTTAATAAAAAAATATCTCACCAAATA IIIIIIIII9II9IIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-54 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:110 YS:i:0 YT:Z:CP LH00652:104:22KG7JLT4:7:1101:8362:1084_2:N:0:GAGAGTAC+TGCTTCCA/2 163 Porites_evermani_scaffold_429_GA_converted 122594 37 110M = 122579 -125 AAAAATCACAAAATAAACTTTATTTAAATCAATTTTTTCCAAAAAAAATAACAACAATAAACAATTCTTTTAATAAAAAAATATCTCACCAAATAATAATCACTAAAAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-40 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:110 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to POR-72-TP2_R1_001.fastp-trim_bismark_bt2_pe.bam <<< Reading in the sequence files ../data/03-Peve-bismark/POR-72-TP2_R1_001.fastp-trim.fq.gz and ../data/03-Peve-bismark/POR-72-TP2_R2_001.fastp-trim.fq.gz Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1101:14510:1841_1:N:0:GAGAGTAC+TGCTTCCA Porites_evermani_scaffold_7247 2 10000 reads; of these: 10000 (100.00%) were paired; of these: 5151 (51.51%) aligned concordantly 0 times 2634 (26.34%) aligned concordantly exactly 1 time 2215 (22.15%) aligned concordantly >1 times 48.49% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 5168 (51.68%) aligned concordantly 0 times 2704 (27.04%) aligned concordantly exactly 1 time 2128 (21.28%) aligned concordantly >1 times 48.32% overall alignment rate Processed 10000 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 40004. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 40004. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 40004. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 40004. Successfully deleted the temporary files POR-72-TP2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and POR-72-TP2_R2_001.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 331653 Total methylated C's in CpG context: 3835 Total methylated C's in CHG context: 221 Total methylated C's in CHH context: 936 Total methylated C's in Unknown context: 5 Total unmethylated C's in CpG context: 49586 Total unmethylated C's in CHG context: 57632 Total unmethylated C's in CHH context: 219443 Total unmethylated C's in Unknown context: 443 C methylated in CpG context: 7.2% C methylated in CHG context: 0.4% C methylated in CHH context: 0.4% C methylated in unknown context (CN or CHN): 1.1% Bismark completed in 0d 0h 0m 16s ==================== Bismark run complete ==================== gzip: stdout: Broken pipe gzip: stdout: Broken pipe gzip: stdout: Broken pipe