Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ (absolute path is '/home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/)' FastQ format assumed (by default) Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/code'): /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/2C2_R1_001.fastp-trim.fq.gz /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/2C2_R2_001.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/output/14-Apul-bismark/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/code Now reading in and storing sequence information of the genome specified in: /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/2C2_R1_001.fastp-trim.fq.gz and /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/2C2_R2_001.fastp-trim.fq.gz Input files are in FastQ format Writing a C -> T converted version of the input file 2C2_R1_001.fastp-trim.fq.gz to 2C2_R1_001.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file 2C2_R1_001.fastp-trim.fq.gz (42517358 sequences in total) Writing a G -> A converted version of the input file 2C2_R2_001.fastp-trim.fq.gz to 2C2_R2_001.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file 2C2_R2_001.fastp-trim.fq.gz (42517358 sequences in total) Input files are 2C2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 2C2_R2_001.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ with the specified options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 2C2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 2C2_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:4641:1084_1:N:0:CAAGGTAC+GAGATACG/1 77 * 0 0 * * 0 0 TTATTGGATTAATGTATATAAGAGTTGTATGTTGAATAGTATAGTAAGTTGTAGAGAAATTTGGTGAATTTAATGTTTTAGGTAGATGGAATTGTAATGAATGTAGGTGTAAAATGGTTGTTGGT IIIIIIIIIIIIIIIIIIII9I-II-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIII9IIIIIIIIIII-I99II9IIIIIIIIIIIII9II9-I-IIIIIIIIIII YT:Z:UP LH00652:104:22KG7JLT4:7:1101:4641:1084_2:N:0:CAAGGTAC+GAGATACG/2 141 * 0 0 * * 0 0 AAAACAAAAATAAATTTAAAACAACATATACAACAACAACATCTAAAATATCCTTCAAAAAACCAACAACCATTTTACACCTACATTCATTACAATTCCATCTACCTAAAACATTAAATTCACCA III9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9-I-IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIII9II9IIIIIIIIIIIIIIIIIIIIIII9IIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 2C2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 2C2_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00652:104:22KG7JLT4:7:1101:4641:1084_1:N:0:CAAGGTAC+GAGATACG/1 83 ptg000008l_GA_converted 22595204 36 125M = 22595143 -186 ACCAACAACCATTTTACACCTACATTCATTACAATTCCATCTACCTAAAACATTAAATTCACCAAATTTCTCTACAACTTACTATACTATTCAACATACAACTCTTATATACATTAATCCAATAA IIIIIIIIIII-I-9II9IIIIIIIIIIIII9II99I-IIIIIIIIIII9IIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-II-I9IIIIIIIIIIIIIIIIIIII AS:i:0 XS:i:-79 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:125 YS:i:0 YT:Z:CP LH00652:104:22KG7JLT4:7:1101:4641:1084_2:N:0:CAAGGTAC+GAGATACG/2 163 ptg000008l_GA_converted 22595143 36 125M = 22595204 186 AAAACAAAAATAAATTTAAAACAACATATACAACAACAACATCTAAAATATCCTTCAAAAAACCAACAACCATTTTACACCTACATTCATTACAATTCCATCTACCTAAAACATTAAATTCACCA III9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIII9-I-IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIII9IIIII9II9IIIIIIIIIIIIIIIIIIIIIII9IIIIIII AS:i:0 XS:i:-87 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:125 YS:i:0 YT:Z:CP >>> Writing bisulfite mapping results to 2C2_pe.bam <<< Reading in the sequence files /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/2C2_R1_001.fastp-trim.fq.gz and /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/2C2_R2_001.fastp-trim.fq.gz Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1191:6534:5568_1:N:0:CAAGGTAC+GAGATACG ptg000007l 12295855 Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1250:13863:5484_1:N:0:CAAGGTAC+GAGATACG ptg000012l 2 Processed 5000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1285:5862:2051_1:N:0:CAAGGTAC+GAGATACG ptg000033l 2625607 Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1302:37187:6955_1:N:0:CAAGGTAC+GAGATACG ptg000066l 66345 Processed 6000000 sequence pairs so far Processed 7000000 sequence pairs so far Processed 8000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1422:42712:4615_1:N:0:CAAGGTAC+GAGATACG ptg000018l 2 Processed 9000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:1432:27341:13667_1:N:0:CAAGGTAC+GAGATACG ptg000015l 14997104 Processed 10000000 sequence pairs so far Processed 11000000 sequence pairs so far Processed 12000000 sequence pairs so far Processed 13000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2190:49224:5022_1:N:0:CAAGGTAC+GAGATACG ptg000016l 13007865 Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2190:49216:5036_1:N:0:CAAGGTAC+GAGATACG ptg000016l 13007865 Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2219:10392:22173_1:N:0:CAAGGTAC+GAGATACG ptg000054l 36026 Processed 14000000 sequence pairs so far Processed 15000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2263:15109:4391_1:N:0:CAAGGTAC+GAGATACG ptg000066l 2 Processed 16000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2328:4843:13289_1:N:0:CAAGGTAC+GAGATACG ptg000098l 55094 Processed 17000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2342:43028:15839_1:N:0:CAAGGTAC+GAGATACG ptg000015l 14997091 Processed 18000000 sequence pairs so far Processed 19000000 sequence pairs so far Processed 20000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:7:2477:19720:9267_1:N:0:CAAGGTAC+GAGATACG ptg000101l 2 Processed 21000000 sequence pairs so far Processed 22000000 sequence pairs so far Processed 23000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:1194:4495:24429_1:N:0:CAAGGTAC+GAGATACG ptg000015l 14997091 Processed 24000000 sequence pairs so far Processed 25000000 sequence pairs so far Processed 26000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:1303:18183:26222_1:N:0:CAAGGTAC+GAGATACG ptg000083l 1 Processed 27000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:1322:19914:21570_1:N:0:CAAGGTAC+GAGATACG ptg000024l 1 Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:1348:49548:26965_1:N:0:CAAGGTAC+GAGATACG ptg000048l 1 Processed 28000000 sequence pairs so far Processed 29000000 sequence pairs so far Processed 30000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:1427:39573:25157_1:N:0:CAAGGTAC+GAGATACG ptg000092l 28994 Processed 31000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:1475:43432:23630_1:N:0:CAAGGTAC+GAGATACG ptg000185l 34510 Processed 32000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:2128:11509:6030_1:N:0:CAAGGTAC+GAGATACG ptg000097l 1 Processed 33000000 sequence pairs so far Processed 34000000 sequence pairs so far Processed 35000000 sequence pairs so far Processed 36000000 sequence pairs so far Processed 37000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:2320:40803:14984_1:N:0:CAAGGTAC+GAGATACG ptg000083l 2 Processed 38000000 sequence pairs so far Processed 39000000 sequence pairs so far Processed 40000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:2413:11808:12658_1:N:0:CAAGGTAC+GAGATACG ptg000015l 14997092 Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:2431:43432:18669_1:N:0:CAAGGTAC+GAGATACG ntLink_1 163090 Processed 41000000 sequence pairs so far Processed 42000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:2481:18887:19230_1:N:0:CAAGGTAC+GAGATACG ptg000096l 1 Chromosomal sequence could not be extracted for LH00652:104:22KG7JLT4:8:2488:46433:20309_1:N:0:CAAGGTAC+GAGATACG ptg000094l 2 42517358 reads; of these: 42517358 (100.00%) were paired; of these: 16432176 (38.65%) aligned concordantly 0 times 8049583 (18.93%) aligned concordantly exactly 1 time 18035599 (42.42%) aligned concordantly >1 times 61.35% overall alignment rate 42517358 reads; of these: 42517358 (100.00%) were paired; of these: 16423581 (38.63%) aligned concordantly 0 times 8045951 (18.92%) aligned concordantly exactly 1 time 18047826 (42.45%) aligned concordantly >1 times 61.37% overall alignment rate Processed 42517358 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 170069432. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 170069432. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 170069432. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 170069432. Successfully deleted the temporary files 2C2_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 2C2_R2_001.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 42517358 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1190692671 Total methylated C's in CpG context: 16520048 Total methylated C's in CHG context: 1299736 Total methylated C's in CHH context: 5158938 Total methylated C's in Unknown context: 62669 Total unmethylated C's in CpG context: 178408348 Total unmethylated C's in CHG context: 204738708 Total unmethylated C's in CHH context: 784566893 Total unmethylated C's in Unknown context: 2919423 C methylated in CpG context: 8.5% C methylated in CHG context: 0.6% C methylated in CHH context: 0.7% C methylated in unknown context (CN or CHN): 2.1% Bismark completed in 0d 2h 49m 43s ==================== Bismark run complete ====================