Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ (absolute path is '/home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/)' FastQ format assumed (by default) Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/code'): /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1H11_R1_001.fastp-trim.fq.gz /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1H11_R2_001.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/output/14-Apul-bismark/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/code Now reading in and storing sequence information of the genome specified in: /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1H11_R1_001.fastp-trim.fq.gz and /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1H11_R2_001.fastp-trim.fq.gz Input files are in FastQ format Writing a C -> T converted version of the input file 1H11_R1_001.fastp-trim.fq.gz to 1H11_R1_001.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file 1H11_R1_001.fastp-trim.fq.gz (37970452 sequences in total) Writing a G -> A converted version of the input file 1H11_R2_001.fastp-trim.fq.gz to 1H11_R2_001.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file 1H11_R2_001.fastp-trim.fq.gz (37970452 sequences in total) Input files are 1H11_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1H11_R2_001.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ with the specified options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 1H11_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1H11_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00526:197:22KFKVLT4:3:1101:50379:1056_1:N:0:GATAGCCA+CTGTGTTG/1 99 ntLink_8_CT_converted 15152789 42 92M = 15152764 -117 ATTTGTTGGAAGTAGGTTTATATTGGAATTGAATATGGTGTGTTGTAAGAGATAAAATGTAGTAAGGTAATAATATAAAAAATTTAATATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:92 YS:i:0 YT:Z:CP LH00526:197:22KFKVLT4:3:1101:50379:1056_2:N:0:GATAGCCA+CTGTGTTG/2 147 ntLink_8_CT_converted 15152764 42 92M = 15152789 117 AATAATTTGTGAAAGAAGAAATAGTATTTGTTGGAAGTAGGTTTATATTGGAATTGAATATGGTGTGTTGTAAGAGATAAAATGTAGTAAGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:92 YS:i:0 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 1H11_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1H11_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00526:197:22KFKVLT4:3:1101:50379:1056_1:N:0:GATAGCCA+CTGTGTTG/1 77 * 0 0 * * 0 0 ATTTGTTGGAAGTAGGTTTATATTGGAATTGAATATGGTGTGTTGTAAGAGATAAAATGTAGTAAGGTAATAATATAAAAAATTTAATATTA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00526:197:22KFKVLT4:3:1101:50379:1056_2:N:0:GATAGCCA+CTGTGTTG/2 141 * 0 0 * * 0 0 CCTTACTACATTTTATCTCTTACAACACACCATATTCAATTCCAATATAAACCTACTTCCAACAAATACTATTTCTTCTTTCACAAATTATT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to 1H11_pe.bam <<< Reading in the sequence files /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1H11_R1_001.fastp-trim.fq.gz and /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1H11_R2_001.fastp-trim.fq.gz Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:1227:35934:15498_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 66366 Processed 4000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 6000000 sequence pairs so far Processed 7000000 sequence pairs so far Processed 8000000 sequence pairs so far Processed 9000000 sequence pairs so far Processed 10000000 sequence pairs so far Processed 11000000 sequence pairs so far Processed 12000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2163:33798:17347_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 1 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2163:33806:17361_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 1 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2163:33798:17375_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 1 Processed 13000000 sequence pairs so far Processed 14000000 sequence pairs so far Processed 15000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2317:4561:29016_1:N:0:GATAGCCA+CTGTGTTG ptg000007l 12295855 Processed 16000000 sequence pairs so far Processed 17000000 sequence pairs so far Processed 18000000 sequence pairs so far Processed 19000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1116:27721:4278_1:N:0:GATAGCCA+CTGTGTTG ptg000099l 50605 Processed 20000000 sequence pairs so far Processed 21000000 sequence pairs so far Processed 22000000 sequence pairs so far Processed 23000000 sequence pairs so far Processed 24000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1310:32066:7794_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 1 Processed 25000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1349:17354:14237_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 66344 Processed 26000000 sequence pairs so far Processed 27000000 sequence pairs so far Processed 28000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1453:30925:20835_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 66347 Processed 29000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1482:31621:19042_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 66346 Processed 30000000 sequence pairs so far Processed 31000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2201:50816:2933_1:N:0:GATAGCCA+CTGTGTTG ptg000015l 14997092 Processed 32000000 sequence pairs so far Processed 33000000 sequence pairs so far Processed 34000000 sequence pairs so far Processed 35000000 sequence pairs so far Processed 36000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2411:11949:12977_1:N:0:GATAGCCA+CTGTGTTG ptg000066l 66348 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2444:45847:17977_1:N:0:GATAGCCA+CTGTGTTG ptg000033l 2625625 Processed 37000000 sequence pairs so far 37970452 reads; of these: 37970452 (100.00%) were paired; of these: 15808533 (41.63%) aligned concordantly 0 times 6676330 (17.58%) aligned concordantly exactly 1 time 15485589 (40.78%) aligned concordantly >1 times 58.37% overall alignment rate 37970452 reads; of these: 37970452 (100.00%) were paired; of these: 15813497 (41.65%) aligned concordantly 0 times 6676017 (17.58%) aligned concordantly exactly 1 time 15480938 (40.77%) aligned concordantly >1 times 58.35% overall alignment rate Processed 37970452 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 151881808. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 151881808. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 151881808. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 151881808. Successfully deleted the temporary files 1H11_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1H11_R2_001.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 37970452 Final Cytosine Methylation Report ================================= Total number of C's analysed: 992770292 Total methylated C's in CpG context: 13247629 Total methylated C's in CHG context: 1064459 Total methylated C's in CHH context: 4116616 Total methylated C's in Unknown context: 50647 Total unmethylated C's in CpG context: 150254801 Total unmethylated C's in CHG context: 170957175 Total unmethylated C's in CHH context: 653129612 Total unmethylated C's in Unknown context: 2436810 C methylated in CpG context: 8.1% C methylated in CHG context: 0.6% C methylated in CHH context: 0.6% C methylated in unknown context (CN or CHN): 2.0% Bismark completed in 0d 2h 21m 38s ==================== Bismark run complete ====================