Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ (absolute path is '/home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/)' FastQ format assumed (by default) Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/code'): /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1B4_R1_001.fastp-trim.fq.gz /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1B4_R2_001.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/output/14-Apul-bismark/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/8TB_HDD_03/sr320/github/timeseries_molecular/D-Apul/code Now reading in and storing sequence information of the genome specified in: /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1B4_R1_001.fastp-trim.fq.gz and /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1B4_R2_001.fastp-trim.fq.gz Input files are in FastQ format Writing a C -> T converted version of the input file 1B4_R1_001.fastp-trim.fq.gz to 1B4_R1_001.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file 1B4_R1_001.fastp-trim.fq.gz (45243764 sequences in total) Writing a G -> A converted version of the input file 1B4_R2_001.fastp-trim.fq.gz to 1B4_R2_001.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file 1B4_R2_001.fastp-trim.fq.gz (45243764 sequences in total) Input files are 1B4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1B4_R2_001.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/data/ with the specified options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 1B4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1B4_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00526:197:22KFKVLT4:3:1101:49165:1056_1:N:0:GGAAGAGA+TTCTCTCG/1 99 ntLink_6_CT_converted 18624975 17 125M = 18625133 283 TATATGTTTGTTTATAAAGTTTTTGATATTAAGAATTTGTTTGTTTTTGTAGTTTGTGTGTGGTTGTTTTTTTTTTATTTTGGTATTTTGTATTAATTTGTGTTTGTATGTTTTTTTATTGGTTG IIIIIII-IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9I-IIII9II9I-IIII9IIIIII9-II-99II9-999I99 AS:i:-12 XS:i:-56 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:109A2A12 YS:i:-6 YT:Z:CP LH00526:197:22KFKVLT4:3:1101:49165:1056_2:N:0:GGAAGAGA+TTCTCTCG/2 147 ntLink_6_CT_converted 18625133 17 125M = 18624975 -283 TTGAAGTGAGAAAATGTATTTTTAGTTTATTTAGTTGTTTGTGTTTTTTAGTGTTAGATGTGTTATTGTTGGTTAATTTTTTATTGGTGAATGGTATATTTATGTATGTTATGGTAGTAGTGATT IIIIIIIII-I9IIIII9IIIII9IIII-III9IIIIIIIII-IIIIIIIIIIIIIIIIIIIII-IIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XS:i:-24 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:42A82 YS:i:-12 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 1B4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1B4_R2_001.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00526:197:22KFKVLT4:3:1101:49165:1056_1:N:0:GGAAGAGA+TTCTCTCG/1 77 * 0 0 * * 0 0 TATATGTTTGTTTATAAAGTTTTTGATATTAAGAATTTGTTTGTTTTTGTAGTTTGTGTGTGGTTGTTTTTTTTTTATTTTGGTATTTTGTATTAATTTGTGTTTGTATGTTTTTTTATTGGTTG IIIIIII-IIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9II9I-IIII9II9I-IIII9IIIIII9-II-99II9-999I99 YT:Z:UP LH00526:197:22KFKVLT4:3:1101:49165:1056_2:N:0:GGAAGAGA+TTCTCTCG/2 141 * 0 0 * * 0 0 AATCACTACTACCATAACATACATAAATATACCATTCACCAATAAAAAATTAACCAACAATAACACATCTAACACTAAAAAACACAAACAACTAAATAAACTAAAAATACATTTTCTCACTTCAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIII-IIIIIIIIIIIIIIIIIIIII-IIIIIIIII9III-IIII9IIIII9IIIII9I-IIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to 1B4_pe.bam <<< Reading in the sequence files /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1B4_R1_001.fastp-trim.fq.gz and /home/shared/8TB_HDD_01/sam/gitrepos/urol-e5/timeseries_molecular/D-Apul/output/01.20-D-Apul-WGBS-trimming-fastp-FastQC-MultiQC/1B4_R2_001.fastp-trim.fq.gz Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:1123:4302:5511_1:N:0:GGAAGAGA+TTCTCTCG ptg000024l 2 Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:1243:18503:17039_1:N:0:GGAAGAGA+TTCTCTCG ptg000029c 1802547 Processed 5000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:1262:37132:9923_1:N:0:GGAAGAGA+TTCTCTCG ptg000101l 31123 Processed 6000000 sequence pairs so far Processed 7000000 sequence pairs so far Processed 8000000 sequence pairs so far Processed 9000000 sequence pairs so far Processed 10000000 sequence pairs so far Processed 11000000 sequence pairs so far Processed 12000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:1494:36323:7205_1:N:0:GGAAGAGA+TTCTCTCG ptg000185l 34486 Processed 13000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2103:33806:28707_1:N:0:GGAAGAGA+TTCTCTCG ptg000029c 1802547 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2110:6891:6659_1:N:0:GGAAGAGA+TTCTCTCG ptg000007l 12295855 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2130:42877:8578_1:N:0:GGAAGAGA+TTCTCTCG ptg000012l 1 Processed 14000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2183:37982:4306_1:N:0:GGAAGAGA+TTCTCTCG ptg000015l 14997092 Processed 15000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2220:40126:27909_1:N:0:GGAAGAGA+TTCTCTCG ptg000006l 1 Processed 16000000 sequence pairs so far Processed 17000000 sequence pairs so far Processed 18000000 sequence pairs so far Processed 19000000 sequence pairs so far Processed 20000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2416:10104:10960_1:N:0:GGAAGAGA+TTCTCTCG ptg000002l 1 Processed 21000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2434:30731:24169_1:N:0:GGAAGAGA+TTCTCTCG ptg000039l 1 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:3:2434:30723:24183_1:N:0:GGAAGAGA+TTCTCTCG ptg000039l 1 Processed 22000000 sequence pairs so far Processed 23000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1115:8947:21003_1:N:0:GGAAGAGA+TTCTCTCG ptg000007l 12295855 Processed 24000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1161:6050:13103_1:N:0:GGAAGAGA+TTCTCTCG ptg000141l 1 Processed 25000000 sequence pairs so far Processed 26000000 sequence pairs so far Processed 27000000 sequence pairs so far Processed 28000000 sequence pairs so far Processed 29000000 sequence pairs so far Processed 30000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1343:22841:11800_1:N:0:GGAAGAGA+TTCTCTCG ptg000165l 24782 Processed 31000000 sequence pairs so far Processed 32000000 sequence pairs so far Processed 33000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1443:10460:26116_1:N:0:GGAAGAGA+TTCTCTCG ptg000039l 1 Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:1451:16812:17809_1:N:0:GGAAGAGA+TTCTCTCG ptg000066l 66348 Processed 34000000 sequence pairs so far Processed 35000000 sequence pairs so far Processed 36000000 sequence pairs so far Processed 37000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2196:42214:20149_1:N:0:GGAAGAGA+TTCTCTCG ptg000033l 2625626 Processed 38000000 sequence pairs so far Processed 39000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2274:17104:2569_1:N:0:GGAAGAGA+TTCTCTCG ptg000066l 66347 Processed 40000000 sequence pairs so far Processed 41000000 sequence pairs so far Processed 42000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2376:14522:13313_1:N:0:GGAAGAGA+TTCTCTCG ptg000074l 12236 Processed 43000000 sequence pairs so far Processed 44000000 sequence pairs so far Processed 45000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00526:197:22KFKVLT4:4:2494:38362:21073_1:N:0:GGAAGAGA+TTCTCTCG ptg000066l 66347 45243764 reads; of these: 45243764 (100.00%) were paired; of these: 15711186 (34.73%) aligned concordantly 0 times 9759332 (21.57%) aligned concordantly exactly 1 time 19773246 (43.70%) aligned concordantly >1 times 65.27% overall alignment rate 45243764 reads; of these: 45243764 (100.00%) were paired; of these: 15700728 (34.70%) aligned concordantly 0 times 9764257 (21.58%) aligned concordantly exactly 1 time 19778779 (43.72%) aligned concordantly >1 times 65.30% overall alignment rate Processed 45243764 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 180975056. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 180975056. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 180975056. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 180975056. Successfully deleted the temporary files 1B4_R1_001.fastp-trim.fq.gz_C_to_T.fastq and 1B4_R2_001.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 45243764 Final Cytosine Methylation Report ================================= Total number of C's analysed: 1421892148 Total methylated C's in CpG context: 26620858 Total methylated C's in CHG context: 1824076 Total methylated C's in CHH context: 7203904 Total methylated C's in Unknown context: 78068 Total unmethylated C's in CpG context: 200549586 Total unmethylated C's in CHG context: 242033059 Total unmethylated C's in CHH context: 943660665 Total unmethylated C's in Unknown context: 3532484 C methylated in CpG context: 11.7% C methylated in CHG context: 0.7% C methylated in CHH context: 0.8% C methylated in unknown context (CN or CHN): 2.2% Bismark completed in 0d 3h 17m 6s ==================== Bismark run complete ====================