Basic Statistics
| Measure | Value |
|---|---|
| Filename | 85--1E11_R1_001.fastp-trim.fq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 20451323 |
| Total Bases | 2.6 Gbp |
| Sequences flagged as poor quality | 0 |
| Sequence length | 15-130 |
| %GC | 39 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| TAAAATGTAGCATCTTCACTACAGATTTAATTTCATTGAATATTTTTTTA | 34234 | 0.1673925936234052 | No Hit |
| TTAAAATGTAGCATCTTCACTACAGATTTAATTTCATTGAATATTTTTTT | 27595 | 0.13493014608394774 | No Hit |
| TCAACAATTAATTGACAATTGATTACGCTACATTATCACAGTCAGTGTTA | 21481 | 0.10503476963324085 | No Hit |