---
author: Sam White
toc-title: Contents
toc-depth: 5
toc-location: left
layout: post
title: PCR - Crassostrea gigas and sikamea Mantle gDNA from Marinellie Shellfish Company - No Multiplex
date: '2019-11-21 15:04'
tags:
  - Crassostrea gigas
  - Crassostrea sikamea
  - Pacific oyster
  - Kumamoto
  - PCR
  - Apex
  - gel
categories:
  - 2019
  - Miscellaneous
---

### UPDATE 20191125

Since the results I obtained on my [final attempt to get this to work](https://robertslab.github.io/sams-notebook/posts/2019/2019-11-21-PCR---Crassostrea-gigas-and-sikamea-Mantle-gDNA-from-Marinellie-Shellfish-Company---No-Multiplex/) failed, I decided to double-check the primer sequences.

Well, I ordered/used the wrong sequences! The two general _Crassostrea spp._ primers ordered were the 28s primers listed in that paper, instead of the cytochrome oxidase primers! I've ordered the correct universal CO primers [which are actually listed in this paper: ([Folmer, O., M. Black, W. Hoeh, R. Lutz & R. Vrijenhoek. 1994. DNA
primers for amplification of mitochondrial cytochrome C oxidase
subunit I from diverse metazoan invertebrate. Mol. Mar. Biol.
Biotechnol. 3:294–299.](https://www.researchgate.net/publication/15316743_DNA_primers_for_amplification_of_mitochondrial_Cytochrome_C_oxidase_subunit_I_from_diverse_metazoan_invertebrates)) and will re-run this.

I'm leaving the original post below for posterity.

---

Primers and cycling parameters were taken from this publication:

- [Haiyan Wang and Ximing Guo "Identification of Crassostrea ariakensis and Related Oysters by Multiplex Species-Specific PCR," Journal of Shellfish Research 27(3), 481-487, (1 May 2008).](https://www.researchgate.net/profile/Ximing_Guo/publication/259643859_Identification_of_Crassostrea_ariakensis_and_related_oysters_by_multiplex_species-specific_PCR/links/55c79eb708aeb9756746e35e/Identification-of-Crassostrea-ariakensis-and-related-oysters-by-multiplex-species-specific-PCR.pdf)

| SR ID | Primer Name | Sequence                   |
|-------|-------------|----------------------------|
| 1727  | COreverse   | CAGGGGGCCGTTCGCGGTCAACGCT  |
| 1726  | COCsi546r   | AAGTAACCTTAATAGATCAGGGAACC |
| 1725  | COCgi269r   | TCGAGGAAATTGCATGTCTGCTACAA |
| 1724  | COforward   | GGGACTACCCCCTGAATTTAAGCAT  |

Instead of running a multiplex PCR as before, I ran each set of species-specific primer pairs independently.

The COforward/reverse primers should amplify any _Crassostrea spp._ DNA (i.e. a positive control - 697bp) and the other two primers will amplify either _C.gigas_ (Cgi269r - 269bp) or _C.sikamea_ (Csi546r - 546bp).

Master mix calcs:

| Component              | Single Rxn Vol. (uL) | Num. Rxns | Total Volumes (uL)        |
|------------------------|----------------------|-----------|---------------------------|
| DNA                    | 4                    | NA        | NA                        |
| 2x Apex Master Mix | 12.5                 | 18        | 225                       |
| COforward (100uM)              | 0.15                 | 18        | 2.7                       |
| reverse primer (100uM)           | 0.10                 | 18        | 1.8                       |
| H2O                    | 8.25                    | 18        | 148.5                       |
|                        | 25                   |           | Add 21uL to each PCR tube |


Cycling params:

95<sup>o</sup>C for 10mins

30 cycles of:

- 95<sup>o</sup>C 1min
- 51<sup>o</sup>C 1min
- 72<sup>o</sup>C 1min

72<sup>o</sup>C 10mins


Used the GeneRuler DNA Ladder Mix (ThermoFisher) for all gels:

![GeneRuler DNA Ladder Mix](https://github.com/RobertsLab/resources/blob/master/protocols/Commercial_Protocols/ThermoFisher_OgeneRuler_DNA_Ladder_Mix_F100439.jpg?raw=true)

---

# RESULTS

GEL: _C.gigas_-specific primers:

![Gel image from C.gigas-specific primers](https://github.com/RobertsLab/sams-notebook/blob/master/images/20191121_gel_Cgigas_primers.jpg?raw=true)

---

GEL: _C.sikamea_-specific primers:

![Gel image from C.sikamea-specific primers](https://github.com/RobertsLab/sams-notebook/blob/master/images/20191121_gel_Csikamea_primers.jpg?raw=true)

---

GEL: _Crassostrea spp._ primers:

![Gel image from Crassostrea species primers](https://github.com/RobertsLab/sams-notebook/blob/master/images/20191121_gel_Crassostrea.sp_primers.jpg?raw=true)

---

Well, it looks like the two species-specific reverse primers don't seem to work with the _Crassostrea spp._ forward primer.

However, the _Crassostrea spp._, despite the fact that they function properly (in that they amplify in all _Crassostrea_ DNA), they don't produce the expected band size that's mentioned in the paper (697bp). Talking with Steven, I don't think we're going to pursue much more of this.