--- author: Sam White toc-title: Contents toc-depth: 5 toc-location: left date: 2015-08-19 23:11:21+00:00 layout: post slug: rad-seq-library-prep-reagents title: RAD-Seq Library Prep Reagents categories: - 2015 - 2bRAD Library Tests for Sequencing at Genewiz - Reagent Prep tags: - AlfI - RAD-seq --- A box with the above title was established in the -20C in FTR 209 containing the following: * Thermo Scientific AlfI: ER1801 * NEB T4 DNA ligase, 50 μL: M0202S * NEB 10 mM ATP, 1 mL: P0756S * Promega dNTPs (10 mM each): U1511 * NEB Q5 Taq Polymerase, 100 units: M0491S Oligos (100μL each in TE pH=8.0; barcode sequences are in bold) Adaptor 1 5ILL-NR: CTACACGACGCTCTTCCGATCTNR Anti-ILL: AGATCGGAAGAGC(InvdT) Adaptor 2 3ILL-NR: CAGACGTGTGCTCTTCCGATCTNR ILL-Lib1: AATGATACGGCGACCACCGA ILL-Lib2: CAAGCAGAAGACGGCATACGA ILL-HT1: AATGATACGGCGACCACCGAGATCTACAC**ATGCAT**ACACTCTTTCCCTACACGACGCTCTTCCGATCT ILL-HT2:AATGATACGGCGACCACCGAGATCTACAC**CGTACG**ACACTCTTTCCCTACACGACGCTCTTCCGATCT ILL-BC1: CAAGCAGAAGACGGCATACGAGAT**CGTGAT**GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC