Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is ../data/ (absolute path is '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/)' FastQ format assumed (by default) Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code'): ../data/109M_R1.fastp-trim.fq.gz ../data/109M_R2.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/01.2-bismark/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code Now reading in and storing sequence information of the genome specified in: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../data/109M_R1.fastp-trim.fq.gz and ../data/109M_R2.fastp-trim.fq.gz Input files are in FastQ format Writing a C -> T converted version of the input file 109M_R1.fastp-trim.fq.gz to 109M_R1.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file 109M_R1.fastp-trim.fq.gz (92317454 sequences in total) Writing a G -> A converted version of the input file 109M_R2.fastp-trim.fq.gz to 109M_R2.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file 109M_R2.fastp-trim.fq.gz (92317454 sequences in total) Input files are 109M_R1.fastp-trim.fq.gz_C_to_T.fastq and 109M_R2.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ with the specified options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 109M_R1.fastp-trim.fq.gz_C_to_T.fastq and 109M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1332:1014_1:N:0:ACAGATCA+TACTGCTC/1 99 NC_086380.1_CT_converted 78362796 23 38M1D68M = 78362776 -127 GATAAATAGTTAAAATTTATATATTGATATGTTTTGTGTTTTTTTTTATATTGTTTTGAATTTTAAGTATGTTGTTTTTATTGATTTTTTTATTTTTGTATTTTTT -II9II-IIII9II-II-9III-I9-I-III9III9IIII-I9I9-I-I-III--IIIIII-9II9I-9II---9999---9-99---9I--999--99-999999 AS:i:-56 XN:i:0 XM:i:8 XO:i:1 XG:i:1 NM:i:9 MD:Z:19A18^T15G0A6A11A2A7A16A4 YS:i:-50 YT:Z:CP LH00469:254:22HGFVLT4:2:1101:1332:1014_2:N:0:ACAGATCA+TACTGCTC/2 147 NC_086380.1_CT_converted 78362776 23 58M1D48M = 78362796 127 ATAGTTATATTGTTGAATTAGATAAATAGTTGGAAGTTAGATATTGATATGTTTTGTGTTTTGTTTTATATTGGATTGAATATTAAGTATGTTATTTTTATTGAGT II9II9IIIII99I9II99I9-III-9I999--9I-I9I-IIIIIII99II-IIIIIIIII9--I9I9I-9IIII-IIIIIIIIIIIIIIII9-9II9I9IIII-- AS:i:-50 XN:i:0 XM:i:7 XO:i:1 XG:i:1 NM:i:8 MD:Z:31A0A2T3A18^T4T33A7A1 YS:i:-56 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 109M_R1.fastp-trim.fq.gz_C_to_T.fastq and 109M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1332:1014_1:N:0:ACAGATCA+TACTGCTC/1 83 NW_026963295.1_GA_converted 4473946 2 50M4I4M1I47M = 4473966 121 AAAAAATACAAAAATAAAAAAATCAATAAAAACAACATACTTAAAATTCAAAACAATATAAAAAAAAACACAAAACATATCAATATATAAATTTTAACTATTTATC 999999-99--999--I9---99-9---9999---II9-I9II9-IIIIII--III-I-I-9I9I-IIII9III9III-I-9I-III9-II-II9IIII-II9II- AS:i:-91 XS:i:-95 XN:i:0 XM:i:11 XO:i:2 XG:i:5 NM:i:16 MD:Z:4T16T4A2T2T11T6T22C6T5A4A8 YS:i:-91 YT:Z:CP LH00469:254:22HGFVLT4:2:1101:1332:1014_2:N:0:ACAGATCA+TACTGCTC/2 163 NW_026963295.1_GA_converted 4473966 2 32M4I2M1I67M = 4473946 -121 ACTCAATAAAAATAACATACTTAATATTCAATCCAATATAAAACAAAACACAAAACATATCAATATCTAACTTCCAACTATTTATCTAATTCAACAATATAACTAT --IIII9I9II9-9IIIIIIIIIIIIIIII-IIII9-I9I9I--9IIIIIIIII-II99IIIIIII-I9I-I9--999I9-III-9I99II9I99IIIII9II9II AS:i:-91 XS:i:-95 XN:i:0 XM:i:11 XO:i:2 XG:i:5 NM:i:16 MD:Z:1T4A2T28A15C6T3A1A0T0T2A28 YS:i:-91 YT:Z:CP >>> Writing bisulfite mapping results to 109M_pe.bam <<< Reading in the sequence files ../data/109M_R1.fastp-trim.fq.gz and ../data/109M_R2.fastp-trim.fq.gz Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1105:20154:12192_1:N:0:ACAGCTCA+TACTGCTC NW_026963299.1 2 Processed 1000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1119:17816:16072_1:N:0:ACAGCTCA+TACTGCTC NW_026963316.1 1 Processed 2000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1127:25803:15498_1:N:0:ACAGCTCA+TACTGCTC NW_026963315.1 4066329 Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1133:14118:5749_1:N:0:ACAGCTCA+TACTGCTC NW_026963308.1 1 Processed 4000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1147:31661:3339_1:N:0:ACAGCTCA+TACTGCTC NW_026963389.1 32310 Processed 5000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1150:51148:20541_1:N:0:ACAGCTCA+TACTGCTC NW_026963415.1 1 Processed 6000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1162:32187:23328_1:N:0:ACAGCTCA+TACTGCTC NW_026963377.1 2 Processed 7000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1172:20098:15820_1:N:0:ACAGCTCA+TACTGCTC NW_026963312.1 1 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1175:48008:16619_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18492 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1179:25447:17403_1:N:0:ACAGCTCA+TCCTGCTC NW_026963804.1 1 Processed 8000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1187:40005:3830_1:N:0:ACAGCTCA+TACTGCTC NW_026963781.1 2 Processed 9000000 sequence pairs so far Processed 10000000 sequence pairs so far Processed 11000000 sequence pairs so far Processed 12000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1226:2659:28245_1:N:0:ACAGCTCA+TACTGCTC NW_026963326.1 2 Processed 13000000 sequence pairs so far Processed 14000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1245:37561:16633_1:N:0:ACAGCTCA+TACTGCTC NW_026963363.1 418881 Processed 15000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1258:43225:18678_1:N:0:ACAGCTCA+TACTGCTC NW_026963681.1 1 Processed 16000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1267:49731:1981_1:N:0:ACAGCTCA+TACTGCTC NW_026963345.1 224348 Processed 17000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1270:15938:6267_1:N:0:ACAGCTCA+TACTGCTC NW_026963687.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1273:41000:13397_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18472 Processed 18000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1282:34550:13131_1:N:0:ACAGCTCA+TACTGCTC NW_026963305.1 2 Processed 19000000 sequence pairs so far Processed 20000000 sequence pairs so far Processed 21000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1321:13786:15792_1:N:0:ACAGCTCA+TACTGCTC NW_026963402.1 95207 Processed 22000000 sequence pairs so far Processed 23000000 sequence pairs so far Processed 24000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1346:44148:15064_1:N:0:ACAGCTCA+TACTGCTC NW_026963590.1 1 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1346:44140:15078_1:N:0:ACAGCTCA+TACTGCTC NW_026963590.1 1 Processed 25000000 sequence pairs so far Processed 26000000 sequence pairs so far Processed 27000000 sequence pairs so far Processed 28000000 sequence pairs so far Processed 29000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1404:39268:8074_1:N:0:ACAGCTCA+TACTGCTC NW_026963307.1 124891 Processed 30000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:1411:10767:28301_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18531 Processed 31000000 sequence pairs so far Processed 32000000 sequence pairs so far Processed 33000000 sequence pairs so far Processed 34000000 sequence pairs so far Processed 35000000 sequence pairs so far Processed 36000000 sequence pairs so far Processed 37000000 sequence pairs so far Processed 38000000 sequence pairs so far Processed 39000000 sequence pairs so far Processed 40000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2119:13859:17179_1:N:0:ACAGCTCA+TACTGCTC NW_026963316.1 1 Processed 41000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2122:45135:21227_1:N:0:ACAGCTCA+TACTGCTC NW_026963616.1 36408 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2124:46446:3858_1:N:0:ACAGCTCA+TACTGCTC NW_026963315.1 4066329 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2131:15501:12458_1:N:0:ACAGCTCA+TACTGCTC NW_026963794.1 13135 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2131:15517:12458_1:N:0:ACAGCTCA+TACTGCTC NW_026963794.1 13135 Processed 42000000 sequence pairs so far Processed 43000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2142:19216:16927_1:N:0:ACAGCTCA+TACTGCTC NW_026963580.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2144:18957:1322_1:N:0:ACAGCTCA+TACTGCTC NW_026963385.1 1 Processed 44000000 sequence pairs so far Processed 45000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2163:32220:8032_1:N:0:ACAGCTCA+TACTGCTC NW_026963502.1 19414 Processed 46000000 sequence pairs so far Processed 47000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2191:39762:3830_1:N:0:ACAGCTCA+TACTGCTC NW_026963307.1 1 Processed 48000000 sequence pairs so far Processed 49000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2209:24095:13663_1:N:0:ACAGCTCA+TACTGCTC NW_026963592.1 19012 Processed 50000000 sequence pairs so far Processed 51000000 sequence pairs so far Processed 52000000 sequence pairs so far Processed 53000000 sequence pairs so far Processed 54000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2260:29282:15302_1:N:0:ACAGCTCA+TACTGCTC NW_026963303.1 1 Processed 55000000 sequence pairs so far Processed 56000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2290:9489:28245_1:N:0:ACAGCTCA+TACTGCTC NW_026963475.1 2 Processed 57000000 sequence pairs so far Processed 58000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2312:10217:24883_1:N:0:ACAGCTCA+TACTGCTC NW_026963377.1 1 Processed 59000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2323:49780:3633_1:N:0:ACAGCTCA+TACTGCTC NW_026963415.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2324:40895:1364_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18495 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2324:41833:4110_1:N:0:ACAGCTCA+TACTGCTC NW_026963307.1 124887 Processed 60000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2335:7288:2387_1:N:0:ACAGCTCA+TACTGCTC NW_026963308.1 3 Processed 61000000 sequence pairs so far Processed 62000000 sequence pairs so far Processed 63000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2367:38572:11744_1:N:0:ACAGCTCA+TACTGCTC NW_026963314.1 2 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2368:10282:23959_1:N:0:ACAGCTCA+TACTGCTC NW_026963480.1 1 Processed 64000000 sequence pairs so far Processed 65000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2385:35991:24169_1:N:0:ACAGCTCA+TACTGCTC NW_026963694.1 1 Processed 66000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2396:39835:20093_1:N:0:ACAGCTCA+TACTGCTC NW_026963303.1 1 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2397:21854:25051_1:N:0:ACAGCTCA+TACTGCTC NC_086378.1 2 Processed 67000000 sequence pairs so far Processed 68000000 sequence pairs so far Processed 69000000 sequence pairs so far Processed 70000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2450:30342:23721_1:N:0:ACAGCTCA+TACTGCTC NW_026963771.1 24028 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2450:30351:23735_1:N:0:ACAGCTCA+TACTGCTC NW_026963771.1 24028 Processed 71000000 sequence pairs so far Processed 72000000 sequence pairs so far Processed 73000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2482:41316:27475_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18503 Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2483:50808:24491_1:N:0:AAAGCTCA+TACTGCTC NW_026963312.1 1 Processed 74000000 sequence pairs so far Processed 75000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00469:254:22HGFVLT4:2:2498:22347:12094_1:N:0:ACAGCTCA+TACTGCTC NW_026963609.1 1 Processed 76000000 sequence pairs so far Processed 77000000 sequence pairs so far Processed 78000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1253:30949:26284_1:N:0:ACAGCTCA+TACTGCTC NW_026963347.1 1227510 Processed 79000000 sequence pairs so far Processed 80000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1335:30812:26634_1:N:0:ACAGCTCA+TACTGCTC NW_026963347.1 1227486 Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1342:30342:11534_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18467 Processed 81000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1363:6729:24309_1:N:0:ACAGCTCA+TACTGCTC NW_026963574.1 19310 Processed 82000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1430:35934:10203_1:N:0:ACAGCTCA+TACTGCTC NW_026963705.1 1 Processed 83000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:1489:50945:2429_1:N:0:ACAGCTCA+TACTGCTC NW_026963430.1 2 Processed 84000000 sequence pairs so far Processed 85000000 sequence pairs so far Processed 86000000 sequence pairs so far Processed 87000000 sequence pairs so far Processed 88000000 sequence pairs so far Chromosomal sequence could not be extracted for LH00586:122:22HTFTLT4:7:2309:3905:12865_1:N:0:ACAGCTCA+TACTGCTC NW_026963684.1 18475 Processed 89000000 sequence pairs so far Processed 90000000 sequence pairs so far Processed 91000000 sequence pairs so far Processed 92000000 sequence pairs so far 92317454 reads; of these: 92317454 (100.00%) were paired; of these: 40343247 (43.70%) aligned concordantly 0 times 18252468 (19.77%) aligned concordantly exactly 1 time 33721739 (36.53%) aligned concordantly >1 times 56.30% overall alignment rate 92317454 reads; of these: 92317454 (100.00%) were paired; of these: 40351163 (43.71%) aligned concordantly 0 times 18257253 (19.78%) aligned concordantly exactly 1 time 33709038 (36.51%) aligned concordantly >1 times 56.29% overall alignment rate Processed 92317454 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 369269816. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 369269816. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 369269816. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 369269816. Successfully deleted the temporary files 109M_R1.fastp-trim.fq.gz_C_to_T.fastq and 109M_R2.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 92317454 Final Cytosine Methylation Report ================================= Total number of C's analysed: 2241569867 Total methylated C's in CpG context: 29871663 Total methylated C's in CHG context: 3262216 Total methylated C's in CHH context: 15251407 Total methylated C's in Unknown context: 367577 Total unmethylated C's in CpG context: 228194535 Total unmethylated C's in CHG context: 356244304 Total unmethylated C's in CHH context: 1608745742 Total unmethylated C's in Unknown context: 12363324 C methylated in CpG context: 11.6% C methylated in CHG context: 0.9% C methylated in CHH context: 0.9% C methylated in unknown context (CN or CHN): 2.9% Bismark completed in 1d 0h 41m 23s ==================== Bismark run complete ==================== Unable to flush stdout: Broken pipe