Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4])
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools'
Reference genome folder provided is ../data/	(absolute path is '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/)'
FastQ format assumed (by default)
Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4
Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary!

Input files to be analysed (in current folder '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code'):
../data/105M_R1.fastp-trim.fq.gz
../data/105M_R2.fastp-trim.fq.gz
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/01.2-bismark/
Setting parallelization to single-threaded (default)

Summary of all aligner options:	-q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500
Current working directory is: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code

Now reading in and storing sequence information of the genome specified in: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/

Single-core mode: setting pid to 1

Paired-end alignments will be performed
=======================================

The provided filenames for paired-end alignments are ../data/105M_R1.fastp-trim.fq.gz and ../data/105M_R2.fastp-trim.fq.gz
Input files are in FastQ format
Writing a C -> T converted version of the input file 105M_R1.fastp-trim.fq.gz to 105M_R1.fastp-trim.fq.gz_C_to_T.fastq

Created C -> T converted version of the FastQ file 105M_R1.fastp-trim.fq.gz (92046634 sequences in total)

Writing a G -> A converted version of the input file 105M_R2.fastp-trim.fq.gz to 105M_R2.fastp-trim.fq.gz_G_to_A.fastq

Created G -> A converted version of the FastQ file 105M_R2.fastp-trim.fq.gz (92046634 sequences in total)

Input files are 105M_R1.fastp-trim.fq.gz_C_to_T.fastq and 105M_R2.fastp-trim.fq.gz_G_to_A.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ with the specified options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 105M_R1.fastp-trim.fq.gz_C_to_T.fastq and 105M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc))
Found first alignment:
LH00469:254:22HGFVLT4:2:1101:1154:1014_1:N:0:NTTACGCA+ATGGCGAT/1	77	*	0	0	*	*	0	0	TATGTAGAGTAATTTGATGTATATGTAAAAATTAGATAAAAGTAATTGAATTATTTATTGTTGATTATATTTTTGTTTTAGTGGGTTAAGATTTATTTGTTTAGGAAGTTGAATTGAAATAAATTTTTATT	IIIIIIIIIIII9IIIIIIIIIIIIIII-IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIII-IIIII9IIIIII9IIIIIIIIIIIIIIII-IIII-IIIIII9IIIII9IIII-IIIIIIIIIIIII	YT:Z:UP
LH00469:254:22HGFVLT4:2:1101:1154:1014_2:N:0:NTTACGCA+ATGGCGAT/2	141	*	0	0	*	*	0	0	TATATCTAAAACTTAAAAATTCAAATAAAAATTTATTTCAATTCAACTTCCTAAACAAATAAATCTTAACCCACTAAAACAAAAATATAATCAACAATAAATAATTCAATTACTTTTATCTAATTTTTACA	9IIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII	YT:Z:UP
Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 105M_R1.fastp-trim.fq.gz_C_to_T.fastq and 105M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw))
Found first alignment:
LH00469:254:22HGFVLT4:2:1101:1154:1014_1:N:0:NTTACGCA+ATGGCGAT/1	83	NC_086383.1_GA_converted	40222960	24	131M	=	40222947	-144	AATAAAAATTTATTTCAATTCAACTTCCTAAACAAATAAATCTTAACCCACTAAAACAAAAATATAATCAACAATAAATAATTCAATTACTTTTATCTAATTTTTACATATACATCAAATTACTCTACATA	IIIIIIIIIIIII-IIII9IIIII9IIIIII-IIII-IIIIIIIIIIIIIIII9IIIIII9IIIII-IIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII-IIIIIIIIIIIIIII9IIIIIIIIIIII	AS:i:-12	XN:i:0	XM:i:2	XO:i:0	XG:i:0	NM:i:2	MD:Z:0T1A128	YS:i:-68	YT:Z:CP
LH00469:254:22HGFVLT4:2:1101:1154:1014_2:N:0:NTTACGCA+ATGGCGAT/2	163	NC_086383.1_GA_converted	40222947	24	4M1I4M3I2M4I6M2I105M	=	40222960	144	TATATCTAAAACTTAAAAATTCAAATAAAAATTTATTTCAATTCAACTTCCTAAACAAATAAATCTTAACCCACTAAAACAAAAATATAATCAACAATAAATAATTCAATTACTTTTATCTAATTTTTACA	9IIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIII	AS:i:-68	XN:i:0	XM:i:3	XO:i:4	XG:i:10	NM:i:13	MD:Z:1T4T6T107	YS:i:-12	YT:Z:CP

>>> Writing bisulfite mapping results to 105M_pe.bam <<<


Reading in the sequence files ../data/105M_R1.fastp-trim.fq.gz and ../data/105M_R2.fastp-trim.fq.gz
Processed 1000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1113:29210:6659_1:N:0:GTTACGCA+ATGGCGAT	NW_026963454.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1113:29193:6687_1:N:0:GTTACGCA+ATGGCGAT	NW_026963454.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1117:11641:2751_1:N:0:GTTACGCA+ATGGCGAT	NW_026963434.1	1
Processed 2000000 sequence pairs so far
Processed 3000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1131:44075:18580_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	1
Processed 4000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1144:10371:1672_1:N:0:GTTACGCA+ATAGCGAT	NW_026963377.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1147:4172:1308_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	1
Processed 5000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1152:41348:28371_1:N:0:GTTACGCA+ATGGCGAT	NW_026963673.1	26140
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1152:41340:28385_1:N:0:GTTACGCA+ATGGCGAT	NW_026963673.1	26140
Processed 6000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1163:23594:25374_1:N:0:GTTACGCA+ATGGCGAT	NW_026963578.1	24262
Processed 7000000 sequence pairs so far
Processed 8000000 sequence pairs so far
Processed 9000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1186:20696:27251_1:N:0:GTTACGCA+ATGGCGAT	NW_026963680.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1187:46349:12823_1:N:0:GTTACGCA+ATGGCGAT	NW_026963566.1	1
Processed 10000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1205:29622:3675_1:N:0:GTTACGCA+ATGGCGAT	NW_026963299.1	1
Processed 11000000 sequence pairs so far
Processed 12000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1215:20737:18804_1:N:0:GTTACGCA+ATGGCGAT	NW_026963616.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1217:27737:14083_1:N:0:GTTACGCA+ATGGCGAT	NW_026963677.1	25110
Processed 13000000 sequence pairs so far
Processed 14000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1234:4018:3984_1:N:0:GTTACGCA+ATGGCGAT	NW_026963551.1	28466
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1239:24880:22530_1:N:0:GTTACGCA+ATGGCGAT	NW_026963612.1	2
Processed 15000000 sequence pairs so far
Processed 16000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1254:48518:17109_1:N:0:GTTACGCA+ATGGCGAT	NW_026963348.1	1
Processed 17000000 sequence pairs so far
Processed 18000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1273:38815:26508_1:N:0:GTTACGCA+ATGGCGAT	NW_026963684.1	18468
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1277:36525:6911_1:N:0:GTTACGCA+ATGGCGAT	NW_026963794.1	13155
Processed 19000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1279:38912:8578_1:N:0:GTTACGCA+ATGGCGAT	NW_026963377.1	2
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1279:38928:8578_1:N:0:GTTACGCA+ATGGCGAT	NW_026963377.1	2
Processed 20000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1289:35125:21353_1:N:0:GTTACGCA+ATGGCGAT	NW_026963452.1	26130
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1295:33353:1756_1:N:0:GTTACGCA+ATGGCGAC	NW_026963740.1	1
Processed 21000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1304:47336:22516_1:N:0:GTTACGCA+ATGGCGAT	NW_026963500.1	1
Processed 22000000 sequence pairs so far
Processed 23000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1321:48768:21830_1:N:0:GTTACGCA+ATGGCGAT	NW_026963362.1	2
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1321:48760:21844_1:N:0:GTTACGCA+ATGGCGAT	NW_026963362.1	2
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1327:8639:21647_1:N:0:GTTACGCA+ATGGCGAT	NW_026963684.1	18468
Processed 24000000 sequence pairs so far
Processed 25000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1343:20672:16619_1:N:0:GTTACGCA+ATGGCGAT	NW_026963443.1	56347
Processed 26000000 sequence pairs so far
Processed 27000000 sequence pairs so far
Processed 28000000 sequence pairs so far
Processed 29000000 sequence pairs so far
Processed 30000000 sequence pairs so far
Processed 31000000 sequence pairs so far
Processed 32000000 sequence pairs so far
Processed 33000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1419:43808:29408_1:N:0:GTTACGCA+ATGGCGAT	NW_026963740.1	2
Processed 34000000 sequence pairs so far
Processed 35000000 sequence pairs so far
Processed 36000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1449:11131:26326_1:N:0:GTTACGCA+ATGGCGAT	NW_026963564.1	19019
Processed 37000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1458:16731:18734_1:N:0:GTTACGCA+ATGGCGAT	NW_026963443.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1458:16723:18748_1:N:0:GTTACGCA+ATGGCGAT	NW_026963443.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1458:16739:18748_1:N:0:GTTACGCA+ATGGCGAT	NW_026963443.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1460:5580:14784_1:N:0:GTTACGCA+ATGGCGAT	NW_026963741.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1465:23780:2835_1:N:0:GTTACGCA+ATGGCGAT	NW_026963689.1	2
Processed 38000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1470:23642:14055_1:N:0:GTTACGCA+ATGGCGAT	NW_026963684.1	18488
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1470:23634:14069_1:N:0:GTTACGCA+ATGGCGAT	NW_026963684.1	18488
Processed 39000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1478:31305:15162_1:N:0:GTTACGCA+ATGGCGAT	NW_026963494.1	2
Processed 40000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:1491:3306:24463_1:N:0:GTTACGCA+ATGGCGAT	NW_026963456.1	1
Processed 41000000 sequence pairs so far
Processed 42000000 sequence pairs so far
Processed 43000000 sequence pairs so far
Processed 44000000 sequence pairs so far
Processed 45000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2139:40255:2387_1:N:0:GTTACGCA+ATGGCGAT	NW_026963552.1	47119
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2142:20025:10763_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	2
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2146:50355:2639_1:N:0:GTTACGCA+ATGGCGAT	NW_026963789.1	26197
Processed 46000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2154:43638:24799_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	1
Processed 47000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2158:31572:22404_1:N:0:GTTACGCA+ATGGCGAT	NW_026963667.1	28274
Processed 48000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2172:22849:27195_1:N:0:GTTACGCA+ATGGCGAT	NW_026963677.1	25109
Processed 49000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2177:36331:20359_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2183:30836:11800_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	2
Processed 50000000 sequence pairs so far
Processed 51000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2201:6260:20471_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	1
Processed 52000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2211:29210:19014_1:N:0:GTTACGCA+ATGGCGAT	NW_026963388.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2215:47927:8578_1:N:0:GTTACGCA+ATGGCGAT	NW_026963576.1	2
Processed 53000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2220:48477:16311_1:N:0:GTTACGCA+ATGGCGAT	NW_026963677.1	25109
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2226:41299:22432_1:N:0:GTTACGCA+ATGGCGAT	NW_026963372.1	501144
Processed 54000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2230:47911:11940_1:N:0:GTTACGCA+ATGGCGAT	NW_026963573.1	20408
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2237:12078:22334_1:N:0:GTTACGCA+ATGGCGAT	NW_026963293.1	2
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2237:12070:22348_1:N:0:GTTACGCA+ATGGCGAT	NW_026963293.1	2
Processed 55000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2243:10419:29072_1:N:0:GTTACGCA+ATGGCGAT	NW_026963663.1	21836
Processed 56000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2258:11488:17809_1:N:0:GTTACGCA+ATGGCGAT	NW_026963675.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2259:16262:19518_1:N:0:GTTACGCN+ATGGCGAT	NW_026963739.1	1
Processed 57000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2268:50144:11800_1:N:0:GTTACGCA+ATGGCGAT	NW_026963581.1	3
Processed 58000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2272:26110:8914_1:N:0:GTTACGCA+ATGGCGAT	NW_026963720.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2274:48558:6057_1:N:0:GTTACGCA+ATGGCGAT	NW_026963635.1	2
Processed 59000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2281:33863:20905_1:N:0:GTTACGCA+ATGGCGAT	NC_007687.1	18555
Processed 60000000 sequence pairs so far
Processed 61000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2305:5766:20653_1:N:0:GTTACGCA+ATGGCGAT	NW_026963362.1	2
Processed 62000000 sequence pairs so far
Processed 63000000 sequence pairs so far
Processed 64000000 sequence pairs so far
Processed 65000000 sequence pairs so far
Processed 66000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2353:10363:28273_1:N:0:GTTACGCA+ATGGCGAT	NW_026963635.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2353:10355:28315_1:N:0:GTTACGCA+ATGGCGAT	NW_026963635.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2353:10371:28315_1:N:0:GTTACGCA+ATGGCGAT	NW_026963635.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2361:48979:7093_1:N:0:GTTACGCA+ATGGCGAT	NW_026963456.1	1
Processed 67000000 sequence pairs so far
Processed 68000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2375:34801:6309_1:N:0:GTTACGCA+ATGGCGAT	NW_026963377.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2375:11479:27573_1:N:0:GTTACGCA+ATGGCGAT	NW_026963737.1	15377
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2384:38394:24939_1:N:0:GTTACGCA+ATGGCGAT	NW_026963456.1	1
Processed 69000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2394:28603:21213_1:N:0:GTTACGCA+ATGGCGAT	NW_026963359.1	1
Processed 70000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2398:38645:18118_1:N:0:GTTACGCA+ATGGCGAT	NW_026963501.1	19448
Processed 71000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2412:27389:10231_1:N:0:GTTACGCA+ATGGCGAT	NW_026963365.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2419:30326:2625_1:N:0:GTTACGCA+ATGGCGAT	NW_026963724.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2419:30334:2639_1:N:0:GTTACGCA+ATGGCGAT	NW_026963365.1	1
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2419:32972:29534_1:N:0:GTTACGCA+ATGGCGAT	NW_026963571.1	1
Processed 72000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2428:34567:20583_1:N:0:GTTACGCA+ATGGCGAT	NW_026963377.1	2
Processed 73000000 sequence pairs so far
Processed 74000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2442:33547:14391_1:N:0:GTTACGCA+ATGGCGAT	NW_026963359.1	23047
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2445:16238:7626_1:N:0:GTTACGCA+ATGGCGAT	NW_026963721.1	2
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2445:16221:7654_1:N:0:GTTACGCA+ATGGCGAT	NW_026963721.1	2
Processed 75000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2454:50961:29464_1:N:0:GTTACGCA+ATGGCGAT	NW_026963634.1	1
Processed 76000000 sequence pairs so far
Processed 77000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2483:27186:5763_1:N:0:GTTACGCA+ATGGCGAT	NW_026963564.1	19021
Processed 78000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2490:3873:20737_1:N:0:GTTACGCA+ATGGCGAT	NW_026963443.1	56347
Processed 79000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00469:254:22HGFVLT4:2:2498:35651:13355_1:N:0:GTTACGCA+ATGGCGAC	NW_026963660.1	48567
Processed 80000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:1163:33288:21115_1:N:0:GTTACGCA+ATGGCGAT	NW_026963720.1	20495
Processed 81000000 sequence pairs so far
Processed 82000000 sequence pairs so far
Processed 83000000 sequence pairs so far
Processed 84000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:1419:35513:7261_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	3
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:1430:1858:26410_1:N:0:GTTACGCA+ATGGCGAT	NW_026963684.1	18481
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:1434:50921:21718_1:N:0:GTTACGCA+ATGGCGAT	NW_026963415.1	1
Processed 85000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:1465:12523:7135_1:N:0:GTTACGCA+ATGGCGAT	NW_026963308.1	1
Processed 86000000 sequence pairs so far
Processed 87000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:2182:40587:7612_1:N:0:GTTACGCA+ATGGCGAT	NW_026963711.1	22997
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:2209:9254:11282_1:N:0:GTTACGCA+ATGGCGAT	NW_026963362.1	2
Processed 88000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:2252:49869:20821_1:N:0:GTTAAGCA+ATGGCGAT	NW_026963415.1	3
Processed 89000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:2333:4909:10960_1:N:0:GTTACGCA+ATGGCGAT	NW_026963443.1	56337
Processed 90000000 sequence pairs so far
Processed 91000000 sequence pairs so far
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:2467:39325:26578_1:N:0:GTTACGCA+ATGGCGAT	NW_026963307.1	124882
Chromosomal sequence could not be extracted for	LH00586:122:22HTFTLT4:7:2491:51342:14321_1:N:0:GTTACGCA+ATGGCGAT	NW_026963725.1	27723
Processed 92000000 sequence pairs so far
92046634 reads; of these:
  92046634 (100.00%) were paired; of these:
    38625345 (41.96%) aligned concordantly 0 times
    17688176 (19.22%) aligned concordantly exactly 1 time
    35733113 (38.82%) aligned concordantly >1 times
58.04% overall alignment rate
92046634 reads; of these:
  92046634 (100.00%) were paired; of these:
    38639516 (41.98%) aligned concordantly 0 times
    17688401 (19.22%) aligned concordantly exactly 1 time
    35718717 (38.81%) aligned concordantly >1 times
58.02% overall alignment rate
Processed 92046634 sequences in total

Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, <IN2> line 368186536.
Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, <IN2> line 368186536.
Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, <IN2> line 368186536.
Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, <IN2> line 368186536.

Successfully deleted the temporary files 105M_R1.fastp-trim.fq.gz_C_to_T.fastq and 105M_R2.fastp-trim.fq.gz_G_to_A.fastq

Final Alignment report
======================
Sequence pairs analysed in total:	92046634
Final Cytosine Methylation Report
=================================
Total number of C's analysed:	2234617939

Total methylated C's in CpG context:	27576663
Total methylated C's in CHG context:	3342875
Total methylated C's in CHH context:	15650550
Total methylated C's in Unknown context:	379722

Total unmethylated C's in CpG context:	234663874
Total unmethylated C's in CHG context:	355646952
Total unmethylated C's in CHH context:	1597737025
Total unmethylated C's in Unknown context:	12407947

C methylated in CpG context:	10.5%
C methylated in CHG context:	0.9%
C methylated in CHH context:	1.0%
C methylated in unknown context (CN or CHN):	3.0%


Bismark completed in 0d 6h 34m 20s

====================
Bismark run complete
====================