Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is ../data/ (absolute path is '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code'): ../data/92M_R1.fastp-trim.fq.gz ../data/92M_R2.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/01.1-bismark-min_score/92M_L-1-0.6/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,-1,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code Now reading in and storing sequence information of the genome specified in: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../data/92M_R1.fastp-trim.fq.gz and ../data/92M_R2.fastp-trim.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../data/92M_R1.fastp-trim.fq.gz Writing a C -> T converted version of the input file 92M_R1.fastp-trim.fq.gz to 92M_R1.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file 92M_R1.fastp-trim.fq.gz (10001 sequences in total) gzip: stdout: Broken pipe Processing reads up to sequence no. 10000 from ../data/92M_R2.fastp-trim.fq.gz Writing a G -> A converted version of the input file 92M_R2.fastp-trim.fq.gz to 92M_R2.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file 92M_R2.fastp-trim.fq.gz (10001 sequences in total) Input files are 92M_R1.fastp-trim.fq.gz_C_to_T.fastq and 92M_R2.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ with the specified options: -q --score-min L,-1,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 92M_R1.fastp-trim.fq.gz_C_to_T.fastq and 92M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,-1,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1218:1014_1:N:0:GTTGTTCG+CCAACTTC/1 99 NC_086377.1_CT_converted 72196896 2 131M = 72197004 239 GTTTTTTTTAATAATATTATATTTTTTAGTAAATTTTATTTTTTTTTTATAATGTATTTTGATATGATATTATATTGATTATATTTTTTAGATAGTTGTATAGAATATGTTTTTAAATTTGTTAATGGTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIII9III-IIIIIIIIIII99IIIIIIIIIIIIIIIIIIIIIII9I AS:i:-66 XS:i:-66 XN:i:0 XM:i:11 XO:i:0 XG:i:0 NM:i:11 MD:Z:0A13A2G29G5T10G22A0A5T13A2A19 YS:i:-60 YT:Z:CP LH00469:254:22HGFVLT4:2:1101:1218:1014_2:N:0:GTTGTTCG+CCAACTTC/2 147 NC_086377.1_CT_converted 72197004 2 131M = 72196896 -239 GTTTTTAAATTTGTTAATGGTTTTAATTAAGGTTTTTTTTTAATTTTATTGTAAATTTGATAATTTTTTTGATAATTGTAATAGATGAAATTTTAAATTGGTTATTTGATTAAGATAGATTTATAATATGT 9IIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIII AS:i:-60 XS:i:-74 XN:i:0 XM:i:10 XO:i:0 XG:i:0 NM:i:10 MD:Z:0A2A25T1A3A1A2A43T3T18T23 YS:i:-66 YT:Z:CP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 92M_R1.fastp-trim.fq.gz_C_to_T.fastq and 92M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,-1,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1218:1014_1:N:0:GTTGTTCG+CCAACTTC/1 83 NC_086377.1_GA_converted 71265141 6 131M = 71265032 -240 AAACCATTAACAAATTTAAAAACATATTCTATACAACTATCTAAAAAATATAATCAATATAATATCATATCAAAATACATTATAAAAAAAAAATAAAATTTACTAAAAAATATAATATTATTAAAAAAAAC I9IIIIIIIIIIIIIIIIIIIIIII99IIIIIIIIIII-III9IIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII AS:i:-36 XS:i:-36 XN:i:0 XM:i:6 XO:i:0 XG:i:0 NM:i:6 MD:Z:19T22T0T33T25A9T17 YS:i:-14 YT:Z:CP LH00469:254:22HGFVLT4:2:1101:1218:1014_2:N:0:GTTGTTCG+CCAACTTC/2 163 NC_086377.1_GA_converted 71265032 6 90M1D41M = 71265141 240 ACATATTATAAATCTATCTTAATCAAATAACCAATTTAAAATTTCATCTATTACAATTATCAAAAAAATTATCAAATTTACAATAAAATTAAAAAAAAACCTTAATTAAAACCATTAACAAATTTAAAAAC IIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9 AS:i:-14 XS:i:-18 XN:i:0 XM:i:1 XO:i:1 XG:i:1 NM:i:2 MD:Z:90^A37T3 YS:i:-36 YT:Z:CP >>> Writing bisulfite mapping results to 92M_L-1-0.6_pe.bam <<< Reading in the sequence files ../data/92M_R1.fastp-trim.fq.gz and ../data/92M_R2.fastp-trim.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 5110 (51.10%) aligned concordantly 0 times 1921 (19.21%) aligned concordantly exactly 1 time 2969 (29.69%) aligned concordantly >1 times 48.90% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 5136 (51.36%) aligned concordantly 0 times 1926 (19.26%) aligned concordantly exactly 1 time 2938 (29.38%) aligned concordantly >1 times 48.64% overall alignment rate Processed 10000 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 40004. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 40004. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 40004. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 40004. Successfully deleted the temporary files 92M_R1.fastp-trim.fq.gz_C_to_T.fastq and 92M_R2.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 210607 Total methylated C's in CpG context: 2827 Total methylated C's in CHG context: 287 Total methylated C's in CHH context: 1362 Total methylated C's in Unknown context: 26 Total unmethylated C's in CpG context: 21524 Total unmethylated C's in CHG context: 33847 Total unmethylated C's in CHH context: 150760 Total unmethylated C's in Unknown context: 736 C methylated in CpG context: 11.6% C methylated in CHG context: 0.8% C methylated in CHH context: 0.9% C methylated in unknown context (CN or CHN): 3.4% Bismark completed in 0d 0h 0m 19s ==================== Bismark run complete ==================== gzip: stdout: Broken pipe gzip: stdout: Broken pipe gzip: stdout: Broken pipe