Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is ../data/ (absolute path is '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code'): ../data/78M_R1.fastp-trim.fq.gz ../data/78M_R2.fastp-trim.fq.gz Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!) Output will be written into the directory: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/output/01.1-bismark-min_score/78M_L0-0.6/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/code Now reading in and storing sequence information of the genome specified in: /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../data/78M_R1.fastp-trim.fq.gz and ../data/78M_R2.fastp-trim.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../data/78M_R1.fastp-trim.fq.gz Writing a C -> T converted version of the input file 78M_R1.fastp-trim.fq.gz to 78M_R1.fastp-trim.fq.gz_C_to_T.fastq Created C -> T converted version of the FastQ file 78M_R1.fastp-trim.fq.gz (10001 sequences in total) gzip: stdout: Broken pipe Processing reads up to sequence no. 10000 from ../data/78M_R2.fastp-trim.fq.gz Writing a G -> A converted version of the input file 78M_R2.fastp-trim.fq.gz to 78M_R2.fastp-trim.fq.gz_G_to_A.fastq Created G -> A converted version of the FastQ file 78M_R2.fastp-trim.fq.gz (10001 sequences in total) Input files are 78M_R1.fastp-trim.fq.gz_C_to_T.fastq and 78M_R2.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 2 instances of Bowtie 2 against the bisulfite genome of /home/shared/16TB_HDD_01/sr320/github/project-mytilus-methylation/data/ with the specified options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from 78M_R1.fastp-trim.fq.gz_C_to_T.fastq and 78M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1688:1014_1:N:0:TGTGACTG+AGCATATC/1 77 * 0 0 * * 0 0 TGGGATTTTATTTTAATATATTATAATTAATTTAGTTTTATGTAAGTTAGTGTGGGTTTGAGATAGTTTGTGTTTTTTATAAATTATATTATTTATATTGAAGAGATTAATTTATATTTTATTATGTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I-IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00469:254:22HGFVLT4:2:1101:1688:1014_2:N:0:TGTGACTG+AGCATATC/2 141 * 0 0 * * 0 0 TAAACATCTTTTAACAAAATAATAAACCTAACTAATTACAATATCAACATTATTTTTCTATCTTAATTCAACAAACACACATTTTACAATCAATAACATTCAAAACAAAACAATTAATAAACCAAAACAAT IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I-IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from 78M_R1.fastp-trim.fq.gz_C_to_T.fastq and 78M_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00469:254:22HGFVLT4:2:1101:1688:1014_1:N:0:TGTGACTG+AGCATATC/1 77 * 0 0 * * 0 0 TGGGATTTTATTTTAATATATTATAATTAATTTAGTTTTATGTAAGTTAGTGTGGGTTTGAGATAGTTTGTGTTTTTTATAAATTATATTATTTATATTGAAGAGATTAATTTATATTTTATTATGTTTTT IIIIIIIIIIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I-IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP LH00469:254:22HGFVLT4:2:1101:1688:1014_2:N:0:TGTGACTG+AGCATATC/2 141 * 0 0 * * 0 0 TAAACATCTTTTAACAAAATAATAAACCTAACTAATTACAATATCAACATTATTTTTCTATCTTAATTCAACAAACACACATTTTACAATCAATAACATTCAAAACAAAACAATTAATAAACCAAAACAAT IIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9I-IIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UP >>> Writing bisulfite mapping results to 78M_L0-0.6_pe.bam <<< Reading in the sequence files ../data/78M_R1.fastp-trim.fq.gz and ../data/78M_R2.fastp-trim.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 4948 (49.48%) aligned concordantly 0 times 1839 (18.39%) aligned concordantly exactly 1 time 3213 (32.13%) aligned concordantly >1 times 50.52% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 4968 (49.68%) aligned concordantly 0 times 1854 (18.54%) aligned concordantly exactly 1 time 3178 (31.78%) aligned concordantly >1 times 50.32% overall alignment rate Processed 10000 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 40004. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 40004. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 40004. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 40004. Successfully deleted the temporary files 78M_R1.fastp-trim.fq.gz_C_to_T.fastq and 78M_R2.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 212483 Total methylated C's in CpG context: 2980 Total methylated C's in CHG context: 297 Total methylated C's in CHH context: 1315 Total methylated C's in Unknown context: 44 Total unmethylated C's in CpG context: 22705 Total unmethylated C's in CHG context: 34410 Total unmethylated C's in CHH context: 150776 Total unmethylated C's in Unknown context: 593 C methylated in CpG context: 11.6% C methylated in CHG context: 0.9% C methylated in CHH context: 0.9% C methylated in unknown context (CN or CHN): 6.9% Bismark completed in 0d 0h 0m 19s ==================== Bismark run complete ==================== gzip: stdout: Broken pipe gzip: stdout: Broken pipe gzip: stdout: Broken pipe