Basic Statistics
| Measure | Value |
|---|---|
| Filename | 47.flexbar_trim.R_1.fastq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 17272203 |
| Total Bases | 2.4 Gbp |
| Sequences flagged as poor quality | 0 |
| Sequence length | 18-150 |
| %GC | 46 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATCTGAATCTGGGGG | 114729 | 0.6642406877686651 | TruSeq Adapter, Index 2 (97% over 37bp) |
| GAAATATTCATATCTTTATTGAGCTGTATTTGATGTACAGTTTTCTTCAT | 30280 | 0.17531058429547175 | No Hit |
| TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT | 20945 | 0.12126420700358836 | No Hit |