Basic Statistics
| Measure | Value |
|---|---|
| Filename | 19-G.flexbar_trim.R_1.fastq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 21250812 |
| Total Bases | 3 Gbp |
| Sequences flagged as poor quality | 0 |
| Sequence length | 18-150 |
| %GC | 47 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCAGAAGAATCTGGGGG | 54455 | 0.25624903180170244 | TruSeq Adapter, Index 5 (97% over 37bp) |
| GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCAGAAGAATCTAGGGG | 29689 | 0.13970760270242852 | TruSeq Adapter, Index 5 (97% over 37bp) |