Examine our input files (intersectBed accepts .bed and .gff files)
head -5 ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_27_22/novel_mature_22_04_2024_t_15_27_22_score-50_to_na.bed
echo ""
head -5 ../output/13.2.1-Pmea-sRNAseq-ShortStack-31bp-fastp-merged-cnidarian_miRBase/ShortStack_out/Results.gff3
browser position
browser hide all
track name="notTrackname.novel_miRNAs" description="novel miRNAs detected by miRDeep2 for notTrackname" visibility=2
itemRgb="On";
Pocillopora_meandrina_HIv1___Sc0000000 20372434 20372456 Pocillopora_meandrina_HIv1___Sc0000000_60202 266239.8 - 20372434 20372456 0,0,255
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack Unknown_sRNA_locus 9092 9521 10746 + . ID=Cluster_1;DicerCall=N;MIRNA=N
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack Unknown_sRNA_locus 53578 53997 286 + . ID=Cluster_2;DicerCall=N;MIRNA=N
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack Unknown_sRNA_locus 150243 150718 2549 - . ID=Cluster_3;DicerCall=N;MIRNA=N
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack siRNA22_locus 173728 174150 1257 + . ID=Cluster_4;DicerCall=22;MIRNA=N
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack Unknown_sRNA_locus 187562 188076 182 . . ID=Cluster_5;DicerCall=N;MIRNA=N
We need to get two input files that contain only mature miRNAs and are correctly formatted. That means we need to remove the header lines of the miRdeep2 mature miRNAs file, and the ShortStack full results file needs to be filtered.
# remove header lines
tail -n +5 ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_27_22/novel_mature_22_04_2024_t_15_27_22_score-50_to_na.bed > ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_27_22/novel_mature_22_04_2024_t_15_27_22_score-50_to_na._formatted.bed
# filter full results to obtain a gff file of only the mature miRNAs
awk -F'\t' '$3 == "mature_miRNA"' ../output/13.2.1-Pmea-sRNAseq-ShortStack-31bp-fastp-merged-cnidarian_miRBase/ShortStack_out/Results.gff3 > ../output/13.2.1-Pmea-sRNAseq-ShortStack-31bp-fastp-merged-cnidarian_miRBase/ShortStack_out/Results_mature.gff3
Check the files
head -5 ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_27_22/novel_mature_22_04_2024_t_15_27_22_score-50_to_na._formatted.bed
echo ""
head -5 ../output/13.2.1-Pmea-sRNAseq-ShortStack-31bp-fastp-merged-cnidarian_miRBase/ShortStack_out/Results_mature.gff3
Pocillopora_meandrina_HIv1___Sc0000000 20372434 20372456 Pocillopora_meandrina_HIv1___Sc0000000_60202 266239.8 - 20372434 20372456 0,0,255
Pocillopora_meandrina_HIv1___Sc0000017 5050957 5050980 Pocillopora_meandrina_HIv1___Sc0000017_655645 67675.4 - 5050957 5050980 0,0,255
Pocillopora_meandrina_HIv1___Sc0000005 601625 601646 Pocillopora_meandrina_HIv1___Sc0000005_273871 65863.2 + 601625 601646 255,0,0
Pocillopora_meandrina_HIv1___xfSc0000017 39556 39581 Pocillopora_meandrina_HIv1___xfSc0000017_985353 65601.9 - 39556 39581 0,0,255
Pocillopora_meandrina_HIv1___Sc0000009 11978171 11978196 Pocillopora_meandrina_HIv1___Sc0000009_442963 64606.4 - 11978171 11978196 0,0,255
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack mature_miRNA 818049 818070 3240 + . ID=Cluster_21.mature;Parent=Cluster_21
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack mature_miRNA 2872041 2872061 110 + . ID=Cluster_37.mature;Parent=Cluster_37
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack mature_miRNA 20372469 20372490 769 - . ID=Cluster_361.mature;Parent=Cluster_361
Pocillopora_meandrina_HIv1___Sc0000001 ShortStack mature_miRNA 19145788 19145809 1102 + . ID=Cluster_759.mature;Parent=Cluster_759
Pocillopora_meandrina_HIv1___Sc0000002 ShortStack mature_miRNA 3841966 3841987 98704 - . ID=Cluster_918.mature;Parent=Cluster_918
Looks good! Now we can input into intersectBed.
# intersectBed to ID sequences in the miRdeep2 mature miRNA output that match mature miRNAs ID'd by ShortStack
# -wa and -wb ensure we recieve full annotations from both input files in the output
/home/shared/bedtools2/bin/intersectBed \
-wa \
-wb \
-a ../output/13.2.1-Pmea-sRNAseq-ShortStack-31bp-fastp-merged-cnidarian_miRBase/ShortStack_out/Results_mature.gff3 \
-b ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_27_22/novel_mature_22_04_2024_t_15_27_22_score-50_to_na._formatted.bed \
&> ../output/17-Pmea-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed
echo "Number of ShortStack mature miRNAs:"
wc -l < ../output/13.2.1-Pmea-sRNAseq-ShortStack-31bp-fastp-merged-cnidarian_miRBase/ShortStack_out/Results_mature.gff3
echo ""
echo "Number of ShortStack mature miRNAs also identified by miRdeep2:"
wc -l < ../output/17-Pmea-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed
Number of ShortStack mature miRNAs:
36
Number of ShortStack mature miRNAs also identified by miRdeep2:
27
While looking through the output file I noticed that two of the intersects originate from the same cluster… not really sure what that’s about…
head -2 ../output/17-Pmea-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack mature_miRNA 818049 818070 3240 + . ID=Cluster_21.mature;Parent=Cluster_21 Pocillopora_meandrina_HIv1___Sc0000000 818048 818071 Pocillopora_meandrina_HIv1___Sc0000000_1750 6153 + 818048 818071 255,0,0
Pocillopora_meandrina_HIv1___Sc0000000 ShortStack mature_miRNA 818049 818070 3240 + . ID=Cluster_21.mature;Parent=Cluster_21 Pocillopora_meandrina_HIv1___Sc0000000 818046 818069 Pocillopora_meandrina_HIv1___Sc0000000_34562 10 - 818046 818069 0,0,255
It looks like they have pretty much identical entries (cluster, coordinates, etc.), except the end of the miRdeep locus name (Pocillopora_meandrina_HIv1_Sc0000000_1750 vs Pocillopora_meandrina_HIv1_Sc0000000_34562) and the miRdeep2 “score” value assigned to them (this is the column following the miRdeep2 locus name, 6153 vs 10). We can also check these two loci in the full miRdeep2 output.
# View full mirdeep2 output for these two loci
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_1750"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv
echo""
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_34562"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv
echo""
echo""
echo "mature miRNA sequences for these two loci:"
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_1750"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv | awk '{print $13}'
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_34562"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv | awk '{print $13}'
echo ""
echo ""
echo "miRNA* sequences for these two loci:"
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_1750"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv | awk '{print $14}'
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_34562"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv | awk '{print $14}'
echo ""
echo ""
echo "precursor miRNA sequences for these two loci:"
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_1750"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv | awk '{print $15}'
awk -F'\t' '$1 == "Pocillopora_meandrina_HIv1___Sc0000000_34562"' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv | awk '{print $15}'
Pocillopora_meandrina_HIv1___Sc0000000_1750 6153 - 12060 11275 0 785 yes - hsa-miR-2117_MIMAT0011162_Homo_sapiens_miR-2117 - - uguucucucugcaguaagcaugu augcuugcuguaaagagaacuug uguucucucugcaguaagcauguuuugacaugcuugcuguaaagagaacuug Pocillopora_meandrina_HIv1___Sc0000000:818048..818100:+
Pocillopora_meandrina_HIv1___Sc0000000_34562 10 - 11 9 0 2 yes - egr-miR-153-5p_MIMAT0037428_Echinococcus_granulosus_miR-153-5p - - augcuuacugcagagagaacaug aaguucucuuuacagcaagcaugucaaa aaguucucuuuacagcaagcaugucaaaacaugcuuacugcagagagaacaug Pocillopora_meandrina_HIv1___Sc0000000:818046..818099:-
mature miRNA sequences for these two loci:
uguucucucugcaguaagcaugu
augcuuacugcagagagaacaug
miRNA* sequences for these two loci:
augcuugcuguaaagagaacuug
aaguucucuuuacagcaagcaugucaaa
precursor miRNA sequences for these two loci:
uguucucucugcaguaagcauguuuugacaugcuugcuguaaagagaacuug
aaguucucuuuacagcaagcaugucaaaacaugcuuacugcagagagaacaug
Interesting… The two loci have very similar precursor sequences and reversed mature and star sequences! In other words, the mature miRNA sequence for Pocillopora_meandrina_HIv1_Sc0000000_1750 is almost identical to the miRNA* sequence of Pocillopora_meandrina_HIv1_Sc0000000_34562, and vice versa! I’m not exactly sure what this means though… is miRdeep2 just incorrectly distinguishing the mature and star sequences for one of these loci? Does the much higher miRdeep2 score of Pocillopora_meandrina_HIv1___Sc0000000_1750 mean we should be more confident in it being correctly distinguished?
Let’s set that aside for now and do some quick investigation of the miRdeep2 evaluation criteria for all of these ShortStack/miRdeep2 shared miRNAs. This could give us an idea of what thresholds may be appropriate for filtering the miRdeep2 output.
mirdeepIDs=$(awk '{print $13}' ../output/17-Pmea-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed)
head -1 ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv > ../output/17-Pmea-ShortStack-miRdeep2-comparison/intersect_miRdeep2_stats.txt
while IFS= read -r id; do
# Use awk to process fileA and match column 1 with the current ID
awk -F'\t' -v id="$id" '$1 == id {print}' ../output/11.1-Pmea-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_27_22.csv
done <<< "$mirdeepIDs" >> ../output/17-Pmea-ShortStack-miRdeep2-comparison/intersect_miRdeep2_stats.txt
intersect_miRdeep2_stats <- read.csv("../output/17-Pmea-ShortStack-miRdeep2-comparison/intersect_miRdeep2_stats.txt", sep="\t")
intersect_miRdeep2_stats %>%
select(miRDeep2.score, significant.randfold.p.value) %>%
arrange(desc(miRDeep2.score)) %>%
kable()
| miRDeep2.score | significant.randfold.p.value |
|---|---|
| 67675.4 | yes |
| 65863.2 | yes |
| 54159.5 | yes |
| 29656.8 | yes |
| 15853.5 | yes |
| 13573.1 | yes |
| 8138.8 | yes |
| 6153.0 | yes |
| 5845.2 | yes |
| 5647.4 | yes |
| 2344.8 | yes |
| 1515.4 | yes |
| 1188.9 | yes |
| 775.3 | yes |
| 712.0 | yes |
| 526.9 | yes |
| 509.1 | yes |
| 184.8 | yes |
| 170.7 | yes |
| 152.7 | yes |
| 136.5 | yes |
| 91.4 | yes |
| 59.1 | yes |
| 10.0 | yes |
| 5.3 | yes |
| 5.2 | yes |
| 5.1 | yes |
The miRdeep2 score is “the log-odds score assigned to the hairpin” and is essentially a probability that the locus is a miRNA (presumably based on the hairpin structure) on, with higher values indicating higher probability. MiRdeep2’s default score threshold for miRNA classification is 0, but coral miRNA papers we’ve seen use myriad thresholds (e.g., 4, 10).
The randfold is also an evaluation of ncrna secondary structure, and we want a significant randfold value (this would indicate high likelihood of miRNA precursory structure)
23 out of 27 shared miRNAs have miRdeep2 scores >10, and all 30 have significant randfold p-values, which is good support for using these thresholds.