Examine our input files (intersectBed accepts .bed and .gff files)
head -5 ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_10_16/novel_mature_22_04_2024_t_15_10_16_score-50_to_na.bed
echo ""
head -5 ../output/08.2-Peve-sRNAseq-ShortStack-31bp-fastp-merged/ShortStack_out/Results.gff3
browser position
browser hide all
track name="notTrackname.novel_miRNAs" description="novel miRNAs detected by miRDeep2 for notTrackname" visibility=2
itemRgb="On";
Porites_evermani_scaffold_1503 46899 46921 Porites_evermani_scaffold_1503_530575 110319.9 + 46899 46921 255,0,0
Porites_evermani_scaffold_1 ShortStack Unknown_sRNA_locus 45711 46131 88 + . ID=Cluster_1;DicerCall=N;MIRNA=N
Porites_evermani_scaffold_1 ShortStack Unknown_sRNA_locus 201507 201931 58 - . ID=Cluster_2;DicerCall=N;MIRNA=N
Porites_evermani_scaffold_1 ShortStack Unknown_sRNA_locus 313446 313846 50 - . ID=Cluster_3;DicerCall=N;MIRNA=N
Porites_evermani_scaffold_1 ShortStack Unknown_sRNA_locus 406146 406734 175 - . ID=Cluster_4;DicerCall=N;MIRNA=N
Porites_evermani_scaffold_1 ShortStack Unknown_sRNA_locus 409839 410269 169 - . ID=Cluster_5;DicerCall=N;MIRNA=N
We need to get two input files that contain only mature miRNAs and are correctly formatted. That means we need to remove the header lines of the miRdeep2 mature miRNAs file, and the ShortStack full results file needs to be filtered.
# remove header lines
tail -n +5 ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_10_16/novel_mature_22_04_2024_t_15_10_16_score-50_to_na.bed > ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_10_16/novel_mature_22_04_2024_t_15_10_16_score-50_to_na._formatted.bed
# filter full results to obtain a gff file of only the mature miRNAs
awk -F'\t' '$3 == "mature_miRNA"' ../output/08.2-Peve-sRNAseq-ShortStack-31bp-fastp-merged/ShortStack_out/Results.gff3 > ../output/08.2-Peve-sRNAseq-ShortStack-31bp-fastp-merged/ShortStack_out/Results_mature.gff3
Check the files
head -5 ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_10_16/novel_mature_22_04_2024_t_15_10_16_score-50_to_na._formatted.bed
echo ""
head -5 ../output/08.2-Peve-sRNAseq-ShortStack-31bp-fastp-merged/ShortStack_out/Results_mature.gff3
Porites_evermani_scaffold_1503 46899 46921 Porites_evermani_scaffold_1503_530575 110319.9 + 46899 46921 255,0,0
Porites_evermani_scaffold_26 382571 382593 Porites_evermani_scaffold_26_42156 46827.4 - 382571 382593 0,0,255
Porites_evermani_scaffold_910 118741 118762 Porites_evermani_scaffold_910_418426 43145.7 + 118741 118762 255,0,0
Porites_evermani_scaffold_72 198220 198245 Porites_evermani_scaffold_72_87796 31859.5 + 198220 198245 255,0,0
Porites_evermani_scaffold_1503 47610 47632 Porites_evermani_scaffold_1503_530579 27800.7 + 47610 47632 255,0,0
Porites_evermani_scaffold_1 ShortStack mature_miRNA 1404272 1404293 3403 - . ID=Cluster_29.mature;Parent=Cluster_29
Porites_evermani_scaffold_16 ShortStack mature_miRNA 383437 383458 1456 - . ID=Cluster_578.mature;Parent=Cluster_578
Porites_evermani_scaffold_26 ShortStack mature_miRNA 382572 382593 69226 - . ID=Cluster_786.mature;Parent=Cluster_786
Porites_evermani_scaffold_47 ShortStack mature_miRNA 475994 476015 240 - . ID=Cluster_1125.mature;Parent=Cluster_1125
Porites_evermani_scaffold_49 ShortStack mature_miRNA 151640 151661 35368 - . ID=Cluster_1153.mature;Parent=Cluster_1153
Looks good! Now we can input into intersectBed.
# intersectBed to ID sequences in the miRdeep2 mature miRNA output that match mature miRNAs ID'd by ShortStack
# -wa and -wb ensure we recieve full annotations from both input files in the output
/home/shared/bedtools2/bin/intersectBed \
-wa \
-wb \
-a ../output/08.2-Peve-sRNAseq-ShortStack-31bp-fastp-merged/ShortStack_out/Results_mature.gff3 \
-b ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/mirna_results_22_04_2024_t_15_10_16/novel_mature_22_04_2024_t_15_10_16_score-50_to_na._formatted.bed \
&> ../output/17-Peve-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed
echo "Number of ShortStack mature miRNAs:"
wc -l < ../output/08.2-Peve-sRNAseq-ShortStack-31bp-fastp-merged/ShortStack_out/Results_mature.gff3
echo ""
echo "Number of ShortStack mature miRNAs also identified by miRdeep2:"
wc -l < ../output/17-Peve-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed
Number of ShortStack mature miRNAs:
46
Number of ShortStack mature miRNAs also identified by miRdeep2:
30
While looking through the output file I noticed that two of the intersects originate from the same cluster… not really sure what that’s about…
head -9 ../output/17-Peve-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed | tail -2
Porites_evermani_scaffold_334 ShortStack mature_miRNA 153605 153626 142 - . ID=Cluster_4722.mature;Parent=Cluster_4722 Porites_evermani_scaffold_334 153606 153626 Porites_evermani_scaffold_334_234019 5.6 - 153606 153626 0,0,255
Porites_evermani_scaffold_334 ShortStack mature_miRNA 153605 153626 142 - . ID=Cluster_4722.mature;Parent=Cluster_4722 Porites_evermani_scaffold_334 153605 153625 Porites_evermani_scaffold_334_233889 5.5 + 153605 153625 255,0,0
It looks like they have pretty much identical entries (cluster, coordinates, etc.), except the end of the miRdeep locus name (Porites_evermani_scaffold_334_234019 vs Porites_evermani_scaffold_334_233889) and the miRdeep2 “score” value assigned to them (this is the column following the miRdeep2 locus name, 5.6 vs 5.1). We can also check these two loci in the full miRdeep2 output.
# View full mirdeep2 output for these two loci
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_234019"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv
echo""
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_233889"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv
echo""
echo""
echo "mature miRNA sequences for these two loci:"
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_234019"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv | awk '{print $13}'
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_233889"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv | awk '{print $13}'
echo ""
echo ""
echo "miRNA* sequences for these two loci:"
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_234019"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv | awk '{print $14}'
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_233889"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv | awk '{print $14}'
echo ""
echo ""
echo "precursor miRNA sequences for these two loci:"
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_234019"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv | awk '{print $15}'
awk -F'\t' '$1 == "Porites_evermani_scaffold_334_233889"' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv | awk '{print $15}'
Porites_evermani_scaffold_334_234019 5.6 - 969 686 0 283 yes - gga-miR-12259-5p_MIMAT0050009_Gallus_gallus_miR-12259-5p - - ugcagguacaguuauaaggu accuuauaacuguaccugccaa ugcagguacaguuauaagguccccuugguggaccuuauaacuguaccugccaa Porites_evermani_scaffold_334:153573..153626:-
Porites_evermani_scaffold_334_233889 5.5 - 111 96 0 15 yes - cpi-miR-9592-5p_MIMAT0037980_Chrysemys_picta_miR-9592-5p - - gaccuuauaacuguaccugc gcagguacaguuauaaggucc gcagguacaguuauaagguccaccaaggggaccuuauaacuguaccugc Porites_evermani_scaffold_334:153576..153625:+
mature miRNA sequences for these two loci:
ugcagguacaguuauaaggu
gaccuuauaacuguaccugc
miRNA* sequences for these two loci:
accuuauaacuguaccugccaa
gcagguacaguuauaaggucc
precursor miRNA sequences for these two loci:
ugcagguacaguuauaagguccccuugguggaccuuauaacuguaccugccaa
gcagguacaguuauaagguccaccaaggggaccuuauaacuguaccugc
Interesting… The two loci have very similar precursor sequences and reversed mature and star sequences! In other words, the mature miRNA sequence for Porites_evermani_scaffold_334_234019 is almost identical to the miRNA* sequence of Porites_evermani_scaffold_334_233889, and vice versa! I’m not exactly sure what this means though… is miRdeep2 just incorrectly distinguishing the mature and star sequences for one of these loci?
Let’s set that aside for now and do some quick investigation of the miRdeep2 evaluation criteria for all of these ShortStack/miRdeep2 shared miRNAs. This could give us an idea of what thresholds may be appropriate for filtering the miRdeep2 output.
mirdeepIDs=$(awk '{print $13}' ../output/17-Peve-ShortStack-miRdeep2-comparison/ShortStack_miRdeep2_mature_intersect.bed)
head -1 ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv > ../output/17-Peve-ShortStack-miRdeep2-comparison/intersect_miRdeep2_stats.txt
while IFS= read -r id; do
# Use awk to process fileA and match column 1 with the current ID
awk -F'\t' -v id="$id" '$1 == id {print}' ../output/11.1-Peve-sRNAseq-miRdeep2-31bp-fastp-merged-cnidarian_miRBase/parsable-result_22_04_2024_t_15_10_16.csv
done <<< "$mirdeepIDs" >> ../output/17-Peve-ShortStack-miRdeep2-comparison/intersect_miRdeep2_stats.txt
intersect_miRdeep2_stats <- read.csv("../output/17-Peve-ShortStack-miRdeep2-comparison/intersect_miRdeep2_stats.txt", sep="\t")
intersect_miRdeep2_stats %>%
select(miRDeep2.score, significant.randfold.p.value) %>%
arrange(desc(miRDeep2.score)) %>%
kable()
| miRDeep2.score | significant.randfold.p.value |
|---|---|
| 46827.4 | yes |
| 43145.7 | yes |
| 22726.6 | yes |
| 17914.4 | yes |
| 16354.3 | yes |
| 13472.1 | yes |
| 6732.5 | yes |
| 4846.3 | yes |
| 3020.5 | yes |
| 2121.3 | yes |
| 2121.2 | yes |
| 1893.3 | yes |
| 1686.5 | yes |
| 1635.5 | yes |
| 1553.3 | yes |
| 1455.3 | yes |
| 1371.1 | yes |
| 1205.2 | yes |
| 998.8 | yes |
| 861.7 | yes |
| 468.6 | yes |
| 204.7 | yes |
| 184.6 | yes |
| 182.4 | yes |
| 5.6 | yes |
| 5.5 | yes |
| 5.5 | yes |
| 5.1 | yes |
| 4.4 | yes |
| 0.4 | yes |
The miRdeep2 score is “the log-odds score assigned to the hairpin” and is essentially a probability that the locus is a miRNA (presumably based on the hairpin structure) on, with higher values indicating higher probability. MiRdeep2’s default score threshold for miRNA classification is 0, but coral miRNA papers we’ve seen use myriad thresholds (e.g., 4, 10).
The randfold is also an evaluation of ncrna secondary structure, and we want a significant randfold value (this would indicate high likelihood of miRNA precursory structure)
25 out of 30 shared miRNAs have miRdeep2 scores >10, and all 30 have significant randfold p-values, which is good support for using these thresholds.