Bowtie 2 seems to be working fine (tested command '/home/shared/bowtie2-2.4.4-linux-x86_64/bowtie2 --version' [2.4.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/usr/bin/samtools' Reference genome folder provided is ../data/ (absolute path is '/home/shared/8TB_HDD_03/sr320/github/deep-dive-expression/F-Ptuh/data/)' FastQ format assumed (by default) Processing sequences up to read no. 100000 from the input file Attention: using more than 4 cores per alignment thread has been reported to have diminishing returns. If possible try to limit -p to a value of 4 Each Bowtie 2 instance is going to be run with 16 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/home/shared/8TB_HDD_03/sr320/github/deep-dive-expression/F-Ptuh/code'): ../data/12-Ptuh-meth/POC-53-TP2_R1.fastp-trim.fq.gz ../data/12-Ptuh-meth/POC-53-TP2_R2.fastp-trim.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Output will be written into the directory: /home/shared/8TB_HDD_03/sr320/github/deep-dive-expression/F-Ptuh/output/12-Ptuh-methylation/POC-53-TP2_score_L0-0.8/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.8 -p 16 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /home/shared/8TB_HDD_03/sr320/github/deep-dive-expression/F-Ptuh/code Now reading in and storing sequence information of the genome specified in: /home/shared/8TB_HDD_03/sr320/github/deep-dive-expression/F-Ptuh/data/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../data/12-Ptuh-meth/POC-53-TP2_R1.fastp-trim.fq.gz and ../data/12-Ptuh-meth/POC-53-TP2_R2.fastp-trim.fq.gz Input files are in FastQ format Processing reads up to sequence no. 100000 from ../data/12-Ptuh-meth/POC-53-TP2_R1.fastp-trim.fq.gz Writing a C -> T converted version of the input file POC-53-TP2_R1.fastp-trim.fq.gz to POC-53-TP2_R1.fastp-trim.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file POC-53-TP2_R1.fastp-trim.fq.gz to POC-53-TP2_R1.fastp-trim.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file POC-53-TP2_R1.fastp-trim.fq.gz (100001 sequences in total) gzip: stdout: Broken pipe Processing reads up to sequence no. 100000 from ../data/12-Ptuh-meth/POC-53-TP2_R2.fastp-trim.fq.gz Writing a C -> T converted version of the input file POC-53-TP2_R2.fastp-trim.fq.gz to POC-53-TP2_R2.fastp-trim.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file POC-53-TP2_R2.fastp-trim.fq.gz to POC-53-TP2_R2.fastp-trim.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file POC-53-TP2_R2.fastp-trim.fq.gz (100001 sequences in total) Input files are POC-53-TP2_R1.fastp-trim.fq.gz_C_to_T.fastq and POC-53-TP2_R1.fastp-trim.fq.gz_G_to_A.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_C_to_T.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /home/shared/8TB_HDD_03/sr320/github/deep-dive-expression/F-Ptuh/data/ with the specified options: -q --score-min L,0,-0.8 -p 16 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from POC-53-TP2_R1.fastp-trim.fq.gz_C_to_T.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.8 -p 16 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/1 77 * 0 0 * * 0 0 TTTTATATTAAATTTAAAAAATAAAAAATAAAAAATAAATAAAATTTTATAAAATTTTTATTAATAAAAATTAAAATTTTGTGGGA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/2 141 * 0 0 * * 0 0 CCTTACACTAAACTTAAAAAACAAAAAACAAAAAATAAATAAAATCCCACAAAATTTCCACCAACAAAAATTAAAATTTTATAAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from POC-53-TP2_R1.fastp-trim.fq.gz_G_to_A.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.8 -p 16 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/1 77 * 0 0 * * 0 0 CCTTACACTAAACTTAAAAAACAAAAAACAAAAAATAAATAAAATCCCACAAAATTTCCACCAACAAAAATTAAAATTTTATAAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/2 141 * 0 0 * * 0 0 TTTTATATTAAATTTAAAAAATAAAAAATAAAAAATAAATAAAATTTTATAAAATTTTTATTAATAAAAATTAAAATTTTGTGGGA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from POC-53-TP2_R1.fastp-trim.fq.gz_G_to_A.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.8 -p 16 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/1 77 * 0 0 * * 0 0 CCTTACACTAAACTTAAAAAACAAAAAACAAAAAATAAATAAAATCCCACAAAATTTCCACCAACAAAAATTAAAATTTTATAAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/2 141 * 0 0 * * 0 0 TTTTATATTAAATTTAAAAAATAAAAAATAAAAAATAAATAAAATTTTATAAAATTTTTATTAATAAAAATTAAAATTTTGTGGGA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from POC-53-TP2_R1.fastp-trim.fq.gz_C_to_T.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.8 -p 16 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/1 77 * 0 0 * * 0 0 TTTTATATTAAATTTAAAAAATAAAAAATAAAAAATAAATAAAATTTTATAAAATTTTTATTAATAAAAATTAAAATTTTGTGGGA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP LH00260:131:22L7V3LT4:3:1101:3970:1014_1:N:0:ATGAGGCC+CNATTAAC/2 141 * 0 0 * * 0 0 CCTTACACTAAACTTAAAAAACAAAAAACAAAAAATAAATAAAATCCCACAAAATTTCCACCAACAAAAATTAAAATTTTATAAAA IIIIIIIIII9IIIIIIIIIIIIIIIIIIIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII- YT:Z:UP >>> Writing bisulfite mapping results to POC-53-TP2_L0-0.8_pe.bam <<< Reading in the sequence files ../data/12-Ptuh-meth/POC-53-TP2_R1.fastp-trim.fq.gz and ../data/12-Ptuh-meth/POC-53-TP2_R2.fastp-trim.fq.gz 100000 reads; of these: 100000 (100.00%) were paired; of these: 99838 (99.84%) aligned concordantly 0 times 77 (0.08%) aligned concordantly exactly 1 time 85 (0.09%) aligned concordantly >1 times 0.16% overall alignment rate 100000 reads; of these: 100000 (100.00%) were paired; of these: 99841 (99.84%) aligned concordantly 0 times 73 (0.07%) aligned concordantly exactly 1 time 86 (0.09%) aligned concordantly >1 times 0.16% overall alignment rate 100000 reads; of these: 100000 (100.00%) were paired; of these: 99845 (99.84%) aligned concordantly 0 times 71 (0.07%) aligned concordantly exactly 1 time 84 (0.08%) aligned concordantly >1 times 0.15% overall alignment rate 100000 reads; of these: 100000 (100.00%) were paired; of these: 99845 (99.84%) aligned concordantly 0 times 71 (0.07%) aligned concordantly exactly 1 time 84 (0.08%) aligned concordantly >1 times 0.15% overall alignment rate Processed 100000 sequences in total Failed to close filehandle AMBIG_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2641, line 400004. Failed to close filehandle AMBIG_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2642, line 400004. Failed to close filehandle UNMAPPED_1: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2643, line 400004. Failed to close filehandle UNMAPPED_2: Bad file descriptor at /home/shared/Bismark-0.24.0/bismark line 2644, line 400004. Successfully deleted the temporary files POC-53-TP2_R1.fastp-trim.fq.gz_C_to_T.fastq, POC-53-TP2_R1.fastp-trim.fq.gz_G_to_A.fastq, POC-53-TP2_R2.fastp-trim.fq.gz_C_to_T.fastq and POC-53-TP2_R2.fastp-trim.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 100000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 900 Total methylated C's in CpG context: 13 Total methylated C's in CHG context: 8 Total methylated C's in CHH context: 701 Total methylated C's in Unknown context: 13 Total unmethylated C's in CpG context: 22 Total unmethylated C's in CHG context: 29 Total unmethylated C's in CHH context: 127 Total unmethylated C's in Unknown context: 6 C methylated in CpG context: 37.1% C methylated in CHG context: 21.6% C methylated in CHH context: 84.7% C methylated in unknown context (CN or CHN): 68.4% Bismark completed in 0d 0h 0m 32s ==================== Bismark run complete ==================== gzip: stdout: Broken pipe gzip: stdout: Broken pipe gzip: stdout: Broken pipe