11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome

Use ShortStack (Axtell 2013; Shahid and Axtell 2014; Johnson et al. 2016)to perform alignment of sRNAseq data and annotation of sRNA-producing genes.

This is the same ShortStack analysis as performed in the deeep-dive project However, we now have a genome for our actual study species, A. pulchra, so we can rerun sRNA discovery with the actual pulchra genome for reference, instead of using A. millipora. Additionally, ShortStack has an updated version, ShortStack 4.1.0, which provides much faster analysis times and additional functionality for visualizing miRNA hairpin structures and generating genome-browser-ready quantitative coverage tracks of aligned small RNAs.

As in deep-dive, we will also include a customized miRBase database, utilizing cnidarian miRNAs curated by Jill Ashley, which includes published cnidarian miRNAs:

• cnidarian-mirbase-mature-v22.1.fasta

---

Inputs:

• Requires trimmed sRNAseq files generated in deep-dive 08.2-Dapul-sRNAseq-trimming-31bp-fastp-merged.Rmd

  • Filenames formatted: *fastp-adapters-polyG-31bp-merged.fq.gz

• A.pulchra genome FastA. Not currently publicly available (still being annotated by colaborators)

Outputs:

• See ShortStack outputs documentation for full list and detailed descriptions.

Software requirements:

• Utilizes a ShortStack Conda/Mamba environment, per the installation instructions.

Replace with name of your ShortStack environment and the path to the corresponding conda installation (find this after you’ve activated the environment).

E.g.

# Activate environment
conda activate ShortStack4_env

# Find conda path
which conda

---

1 Set R variables

shortstack_conda_env_name <- c("ShortStack-4.1.0_env")
shortstack_cond_path <- c("/home/sam/programs/mambaforge/condabin/conda")

2 Create a Bash variables file

This allows usage of Bash variables across R Markdown chunks.

{
echo "#### Assign Variables ####"
echo ""

echo "# Trimmed FastQ naming pattern"
echo "export trimmed_fastqs_pattern='*fastp-adapters-polyG-31bp-merged.fq.gz'"

echo "# Data directories"
echo 'export expression_dir=/home/shared/8TB_HDD_02/shedurkin/deep-dive-expression'
echo 'export expression_data_dir="${expression_dir}/data"'
echo 'export output_dir_top=${expression_dir}/D-Apul/output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome'
echo ""

echo "# Input/Output files"
echo 'export genome_fasta_dir=${expression_dir}/D-Apul/data'
echo 'export genome_fasta_name="Apulchra-genome.fa"'
echo 'export shortstack_genome_fasta_name="Apulchra-genome.fa"'
echo 'export trimmed_fastqs_dir="${genome_fasta_dir}/sRNA-trimmed-reads"'

echo 'export mirbase_mature_fasta_version=cnidarian-mirbase-mature-v22.1.fasta'
echo 'export genome_fasta="${genome_fasta_dir}/${shortstack_genome_fasta_name}"'
echo ""

echo "# Set number of CPUs to use"
echo 'export threads=40'
echo ""

echo "# Initialize arrays"
echo 'export trimmed_fastqs_array=()'


} > .bashvars

cat .bashvars

#### Assign Variables ####

# Trimmed FastQ naming pattern
export trimmed_fastqs_pattern='*fastp-adapters-polyG-31bp-merged.fq.gz'
# Data directories
export expression_dir=/home/shared/8TB_HDD_02/shedurkin/deep-dive-expression
export expression_data_dir="${expression_dir}/data"
export output_dir_top=${expression_dir}/D-Apul/output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome

# Input/Output files
export genome_fasta_dir=${expression_dir}/D-Apul/data
export genome_fasta_name="Apulchra-genome.fa"
export shortstack_genome_fasta_name="Apulchra-genome.fa"
export trimmed_fastqs_dir="${genome_fasta_dir}/sRNA-trimmed-reads"
export mirbase_mature_fasta_version=cnidarian-mirbase-mature-v22.1.fasta
export genome_fasta="${genome_fasta_dir}/${shortstack_genome_fasta_name}"

# Set number of CPUs to use
export threads=40

# Initialize arrays
export trimmed_fastqs_array=()

3 Load ShortStack conda environment

If this is successful, the first line of output should show that the Python being used is the one in your [ShortStack](https://github.com/MikeAxtell/ShortStack conda environment path.

E.g.

python: /home/sam/programs/mambaforge/envs/mirmachine_env/bin/python

use_condaenv(condaenv = shortstack_conda_env_name, conda = shortstack_cond_path)
py_config()

python:         /home/sam/programs/mambaforge/envs/ShortStack-4.1.0_env/bin/python
libpython:      /home/sam/programs/mambaforge/envs/ShortStack-4.1.0_env/lib/libpython3.12.so
pythonhome:     /home/sam/programs/mambaforge/envs/ShortStack-4.1.0_env:/home/sam/programs/mambaforge/envs/ShortStack-4.1.0_env
version:        3.12.7 | packaged by conda-forge | (main, Oct  4 2024, 16:05:46) [GCC 13.3.0]
numpy:          /home/sam/programs/mambaforge/envs/ShortStack-4.1.0_env/lib/python3.12/site-packages/numpy
numpy_version:  2.1.1

NOTE: Python version was forced by use_python() function

Note: I sometimes get an error “failed to initialize requested version of Python,” which seems to stem from the reticulate package default loading a python environment. I’ve been able to fix this by manually uninstalling the reticulate package, then restarting R and reinstalling reticulate before rerunning this code document. # Download reference files

3.1 A.pulchra genome

# Load bash variables into memory
source .bashvars

wget -O ${genome_fasta_dir}/${shortstack_genome_fasta_name} "https://osf.io/download/kn96u/"

3.2 Cnidarian+miRBase database

Available n deep-dive repo, here

# Load bash variables into memory
source .bashvars

wget -O ${expression_data_dir}/"${mirbase_mature_fasta_version}" "https://raw.githubusercontent.com/urol-e5/deep-dive/refs/heads/main/data/cnidarian-mirbase-mature-v22.1.fasta"

# Load bash variables into memory
source .bashvars

head -5 ${expression_data_dir}/"${mirbase_mature_fasta_version}"

>cel-let-7-5p MIMAT0000001 Caenorhabditis elegans let-7-5p
UGAGGUAGUAGGUUGUAUAGUU
>cel-let-7-3p MIMAT0015091 Caenorhabditis elegans let-7-3p
CUAUGCAAUUUUCUACCUUACC
>cel-lin-4-5p MIMAT0000002 Caenorhabditis elegans lin-4-5p

3.3 Trimmed sRNA-seq reads

Trimmed in deep-dive, 08.2-Dapul-sRNAseq-trimming-31bp-fastp-merged.Rmd

# Load bash variables into memory
source .bashvars

wget \
--directory-prefix ${trimmed_fastqs_dir} \
--recursive \
--no-check-certificate \
--continue \
--cut-dirs 7 \
--no-host-directories \
--no-parent \
--quiet \
--accept ${trimmed_fastqs_pattern} \
"https://gannet.fish.washington.edu/Atumefaciens/gitrepos/deep-dive/D-Apul/output/08.2-Apul-sRNAseq-trimming-31bp-fastp-merged/trimmed-reads/"

4 Run ShortStack

4.1 Modify genome filename for ShortStack compatability

# Load bash variables into memory
source .bashvars

# Check for FastA file first
# Then create rename file if doesn't exist
if [ -f "${genome_fasta_dir}/${shortstack_genome_fasta_name}" ]; then
  echo "${genome_fasta_dir}/${shortstack_genome_fasta_name}"
  echo ""
  echo "Already exists. Nothing to do."
  echo ""
else

  # Copy genome FastA to ShortStack-compatible filename (ending with .fa)
  cp ${genome_fasta_dir}/${genome_fasta_name} ${genome_fasta_dir}/${shortstack_genome_fasta_name}
fi

# Confirm
ls -lh ${genome_fasta_dir}/${shortstack_genome_fasta_name}

/home/shared/8TB_HDD_02/shedurkin/deep-dive-expression/D-Apul/data/Apulchra-genome.fa

Already exists. Nothing to do.

-rw-r--r-- 1 shedurkin labmembers 505M Oct  1 13:31 /home/shared/8TB_HDD_02/shedurkin/deep-dive-expression/D-Apul/data/Apulchra-genome.fa

4.2 Excecute ShortStack command

Uses the --dn_mirna option to identify miRNAs in the genome, without relying on the --known_miRNAs.

This part of the code redirects the output of time to the end of shortstack.log file.

• ; } \ 2>> ${output_dir_top}/shortstack.log

# Load bash variables into memory
source .bashvars

# Make output directory, if it doesn't exist
mkdir --parents "${output_dir_top}"

# Create array of trimmed FastQs
trimmed_fastqs_array=(${trimmed_fastqs_dir}/${trimmed_fastqs_pattern})


# Pass array contents to new variable as space-delimited list
trimmed_fastqs_list=$(echo "${trimmed_fastqs_array[*]}")


###### Run ShortStack ######
{ time \
ShortStack \
--genomefile "${genome_fasta}" \
--readfile ${trimmed_fastqs_list} \
--known_miRNAs ${expression_data_dir}/${mirbase_mature_fasta_version} \
--dn_mirna \
--threads ${threads} \
--outdir ${output_dir_top}/ShortStack_out \
&> ${output_dir_top}/shortstack.log ; } \
2>> ${output_dir_top}/shortstack.log

4.3 Check runtime

# Load bash variables into memory
source .bashvars

tail -n 3 ${output_dir_top}/shortstack.log \
| grep "real" \
| awk '{print "ShortStack runtime:" "\t" $2}'

ShortStack runtime: 13m43.312s

5 Results

5.1 ShortStack synopsis

# Load bash variables into memory
source .bashvars

tail -n 25 ${output_dir_top}/shortstack.log

Writing final files

Found a total of 39 MIRNA loci


Non-MIRNA loci by DicerCall:
N 20608
22 78
23 27
21 23
24 14

Creating visualizations of microRNA loci with strucVis
<<< WARNING >>>
Do not rely on these results alone to annotate new MIRNA loci!
The false positive rate for de novo MIRNA identification is low, but NOT ZERO
Insepct each mirna locus, especially the strucVis output, and see
https://doi.org/10.1105/tpc.17.00851 , https://doi.org/10.1093/nar/gky1141

Tue 08 Oct 2024 15:54:04 -0700 PDT
Run Completed!

real    13m43.312s
user    170m20.326s
sys 55m0.571s

ShortStack identified 39 miRNAs. (This is in comparison to running ShortStack using the A. millipora genome, which yielded 38 miRNAs)

5.2 Inspect Results.txt

# Load bash variables into memory
source .bashvars

head ${output_dir_top}/ShortStack_out/Results.txt

echo ""
echo "----------------------------------------------------------"
echo ""

echo "Nummber of potential loci:"
awk '(NR>1)' ${output_dir_top}/ShortStack_out/Results.txt | wc -l

Locus   Name    Chrom   Start   End Length  Reads   DistinctSequences   FracTop Strand  MajorRNA    MajorRNAReads   Short   Long    21  22  23  24  DicerCall   MIRNA   known_miRNAs
ntLink_7:2229-2654  Cluster_1   ntLink_7    2229    2654    426 177 78  0.023   -   UUCUAAGGUCCGUAUCUCCAGUCCUCUGU   47  2   174 1   0   0   0   N   N   NA
ntLink_7:3045-3472  Cluster_2   ntLink_7    3045    3472    428 154 66  0.013   -   UGAACGUAUUUUCUGAAGAAACUGCAA 15  2   151 0   0   0   1   N   N   NA
ntLink_7:9749-10310 Cluster_3   ntLink_7    9749    10310   562 680 184 0.531   .   UCUCAUCAUAUUUAGAAUUUUUGGAAGGA   52  5   651 1   6   11  6   N   N   NA
ntLink_7:21735-22163    Cluster_4   ntLink_7    21735   22163   429 196 72  0.015   -   UUCUAAGGUCCGUAUCUCCAGUCCUCUGC   59  0   195 0   0   0   1   N   N   NA
ntLink_7:22554-22980    Cluster_5   ntLink_7    22554   22980   427 146 59  0.062   -   UGAACGUAUUUUCUGAAGAAACUGCAA 15  1   140 0   3   0   2   N   N   NA
ntLink_7:29261-30185    Cluster_6   ntLink_7    29261   30185   925 808 201 0.532   .   GUCAAGUGCAUCGAUCAAGGAUGGAUCAGG  86  5   777 2   7   9   8   N   N   NA
ntLink_7:39950-40377    Cluster_7   ntLink_7    39950   40377   428 253 26  0.032   -   UAGAUAUACUUCAAGGGAUAAACCAGGU    216 2   240 0   2   1   8   N   N   NA
ntLink_7:41332-41775    Cluster_8   ntLink_7    41332   41775   444 910 242 0.053   -   UGCUGGUCUUGUAAUUCUGAACGUAUAUUG  93  7   887 4   1   3   8   N   N   NA
ntLink_7:42041-42467    Cluster_9   ntLink_7    42041   42467   427 169 60  0.036   -   UCUGAAGAAACUGCAAAGUUCACUGUC 50  3   164 0   1   0   1   N   N   NA

----------------------------------------------------------

Nummber of potential loci:
20789

Column 20 of the Results.txt file identifies if a cluster is a miRNA or not (Y or N).

# Load bash variables into memory
source .bashvars

echo "Number of loci characterized as miRNA:"
awk '$20=="Y" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l
echo ""

echo "----------------------------------------------------------"

echo ""
echo "Number of loci _not_ characterized as miRNA:"
awk '$20=="N" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l

Number of loci characterized as miRNA:
39

----------------------------------------------------------

Number of loci _not_ characterized as miRNA:
20750

Column 21 of the Results.txt file identifies if a cluster aligned to a known miRNA (miRBase) or not (Y or NA).

Since there are no miRNAs, the following code will not print any output.

The echo command after the awk command is simply there to prove that the chunk executed.

# Load bash variables into memory
source .bashvars

echo "Number of loci matching miRBase miRNAs:"
awk '$21!="NA" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l
echo ""

echo "----------------------------------------------------------"

echo ""
echo "Number of loci _not_ matching miRBase miRNAs:"
awk '$21=="NA" {print $0}' ${output_dir_top}/ShortStack_out/Results.txt \
| wc -l

Number of loci matching miRBase miRNAs:
131

----------------------------------------------------------

Number of loci _not_ matching miRBase miRNAs:
20659

Although there are loci with matches to miRBase miRNAs, ShortStack did not annotate these clusters as miRNAs likely because they do not also match secondary structure criteria.

5.2.1 Directory tree of all ShortStack outputs

Many of these are large (by GitHub standards) BAM files, so will not be added to the repo.

Additionally, it’s unlikely we’ll utilize most of the other files (bigwig) generated by ShortStack.

# Load bash variables into memory
source .bashvars

tree -h ${output_dir_top}/

/home/shared/8TB_HDD_02/shedurkin/deep-dive-expression/D-Apul/output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/
├── [4.0K]  figures
│   ├── [140K]  Apul_ShortStack_dbmatch_histogram.png
│   ├── [168K]  Apul_ShortStack_dbmatch_histogram_reduced.png
│   ├── [270K]  Apul_ShortStack_miRNA_histogram.png
│   ├── [268K]  Apul_ShortStack_miRNA_histogram_reduced.png
│   └── [198K]  Apul_ShortStack_venn.png
├── [9.0K]  shortstack.log
└── [ 12K]  ShortStack_out
    ├── [ 30K]  alignment_details.tsv
    ├── [1.2M]  Counts.txt
    ├── [110K]  known_miRNAs.gff3
    ├── [1.8M]  known_miRNAs_unaligned.fasta
    ├── [328M]  merged_alignments.bam
    ├── [213K]  merged_alignments.bam.csi
    ├── [ 11K]  mir.fasta
    ├── [2.0M]  Results.gff3
    ├── [2.8M]  Results.txt
    ├── [ 66M]  sRNA-ACR-140-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam
    ├── [218K]  sRNA-ACR-140-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam.csi
    ├── [255M]  sRNA-ACR-140-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.fa
    ├── [ 73M]  sRNA-ACR-145-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam
    ├── [221K]  sRNA-ACR-145-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam.csi
    ├── [279M]  sRNA-ACR-145-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.fa
    ├── [ 70M]  sRNA-ACR-150-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam
    ├── [220K]  sRNA-ACR-150-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam.csi
    ├── [274M]  sRNA-ACR-150-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.fa
    ├── [ 61M]  sRNA-ACR-173-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam
    ├── [219K]  sRNA-ACR-173-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam.csi
    ├── [235M]  sRNA-ACR-173-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.fa
    ├── [ 58M]  sRNA-ACR-178-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam
    ├── [220K]  sRNA-ACR-178-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.bam.csi
    ├── [218M]  sRNA-ACR-178-S1-TP2-fastp-adapters-polyG-31bp-merged_condensed.fa
    └── [4.0K]  strucVis
        ├── [9.8K]  Cluster_10051.ps.pdf
        ├── [ 22K]  Cluster_10051.txt
        ├── [9.0K]  Cluster_10057.ps.pdf
        ├── [ 42K]  Cluster_10057.txt
        ├── [9.5K]  Cluster_10093.ps.pdf
        ├── [ 30K]  Cluster_10093.txt
        ├── [ 11K]  Cluster_10207.ps.pdf
        ├── [ 40K]  Cluster_10207.txt
        ├── [8.5K]  Cluster_10228.ps.pdf
        ├── [9.9K]  Cluster_10228.txt
        ├── [8.7K]  Cluster_10419.ps.pdf
        ├── [ 15K]  Cluster_10419.txt
        ├── [8.6K]  Cluster_14402.ps.pdf
        ├── [ 10K]  Cluster_14402.txt
        ├── [7.7K]  Cluster_14768.ps.pdf
        ├── [1.2K]  Cluster_14768.txt
        ├── [8.8K]  Cluster_15316.ps.pdf
        ├── [ 15K]  Cluster_15316.txt
        ├── [ 12K]  Cluster_15340.ps.pdf
        ├── [ 29K]  Cluster_15340.txt
        ├── [8.5K]  Cluster_15671.ps.pdf
        ├── [9.6K]  Cluster_15671.txt
        ├── [10.0K]  Cluster_15775.ps.pdf
        ├── [ 46K]  Cluster_15775.txt
        ├── [8.4K]  Cluster_15851.ps.pdf
        ├── [6.2K]  Cluster_15851.txt
        ├── [8.4K]  Cluster_15854.ps.pdf
        ├── [3.4K]  Cluster_15854.txt
        ├── [7.6K]  Cluster_15928.ps.pdf
        ├── [9.1K]  Cluster_15928.txt
        ├── [8.7K]  Cluster_16409.ps.pdf
        ├── [7.3K]  Cluster_16409.txt
        ├── [7.9K]  Cluster_17776.ps.pdf
        ├── [3.6K]  Cluster_17776.txt
        ├── [ 10K]  Cluster_17791.ps.pdf
        ├── [ 52K]  Cluster_17791.txt
        ├── [8.7K]  Cluster_1826.ps.pdf
        ├── [ 36K]  Cluster_1826.txt
        ├── [8.7K]  Cluster_1832.ps.pdf
        ├── [ 22K]  Cluster_1832.txt
        ├── [ 10K]  Cluster_1862.ps.pdf
        ├── [ 24K]  Cluster_1862.txt
        ├── [ 10K]  Cluster_18711.ps.pdf
        ├── [ 42K]  Cluster_18711.txt
        ├── [9.8K]  Cluster_18723.ps.pdf
        ├── [ 11K]  Cluster_18723.txt
        ├── [9.6K]  Cluster_18728.ps.pdf
        ├── [ 63K]  Cluster_18728.txt
        ├── [8.7K]  Cluster_18772.ps.pdf
        ├── [ 14K]  Cluster_18772.txt
        ├── [8.2K]  Cluster_19193.ps.pdf
        ├── [7.3K]  Cluster_19193.txt
        ├── [ 10K]  Cluster_1951.ps.pdf
        ├── [ 20K]  Cluster_1951.txt
        ├── [ 11K]  Cluster_2463.ps.pdf
        ├── [ 33K]  Cluster_2463.txt
        ├── [8.3K]  Cluster_2859.ps.pdf
        ├── [ 21K]  Cluster_2859.txt
        ├── [8.1K]  Cluster_3250.ps.pdf
        ├── [5.4K]  Cluster_3250.txt
        ├── [ 10K]  Cluster_3366.ps.pdf
        ├── [ 20K]  Cluster_3366.txt
        ├── [9.0K]  Cluster_3367.ps.pdf
        ├── [ 24K]  Cluster_3367.txt
        ├── [8.5K]  Cluster_3437.ps.pdf
        ├── [ 24K]  Cluster_3437.txt
        ├── [7.9K]  Cluster_4220.ps.pdf
        ├── [4.9K]  Cluster_4220.txt
        ├── [7.9K]  Cluster_4254.ps.pdf
        ├── [4.5K]  Cluster_4254.txt
        ├── [ 10K]  Cluster_5012.ps.pdf
        ├── [ 59K]  Cluster_5012.txt
        ├── [8.6K]  Cluster_5899.ps.pdf
        ├── [9.3K]  Cluster_5899.txt
        ├── [ 11K]  Cluster_5900.ps.pdf
        ├── [ 44K]  Cluster_5900.txt
        ├── [8.7K]  Cluster_5981.ps.pdf
        └── [ 23K]  Cluster_5981.txt

3 directories, 108 files

5.3 Visualize

We noticed that a) not all of the identified miRNAs have database matches, and b) some reads have a match in the database but are not classified as miRNAs. Let’s look at this in more depth.

Apul_shortstack_results <- read.csv("../output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/ShortStack_out/Results.txt", sep="\t")

# Reads identified as miRNAs (but not necessarily known)
Apul_shortstack_results %>% 
  filter(MIRNA == "Y") %>%
  mutate(known_miRNAs = str_sub(known_miRNAs, 1, 40)) %>%
  mutate(Locus = str_sub(Locus, 20, 40)) %>%
  ggplot(aes(x = reorder(Locus, Reads), y = Reads, fill = known_miRNAs)) +
  geom_bar(stat = "identity") +
   geom_text(aes(label = Reads), vjust = 0.5, hjust = 0, color = "black", size = 2.5, angle = 90) +
  labs(x = "miRNA", y = "Read count", 
       title = "Reads identified by ShortStack as miRNAs",
       fill = "Annotation") +
  theme(axis.text.x = element_blank(),
        axis.ticks.x = element_blank())

ggsave("../output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/figures/Apul_ShortStack_miRNA_histogram.png", width = 12, height = 7, units = "in")


# Reads matched in the reference db (but not necessarily identified as miRNA)
Apul_shortstack_results %>% 
  filter(!is.na(known_miRNAs)) %>%
  mutate(known_miRNAs = str_sub(known_miRNAs, 1, 40)) %>%
  mutate(Locus = str_sub(Locus, 20, 40)) %>%
  ggplot(aes(x = reorder(Locus, Reads), y = Reads, fill = MIRNA)) +
  geom_bar(stat = "identity") +
  geom_text(aes(label = Reads), vjust = 0.5, hjust = 0, color = "black", size = 2.5, angle = 90) +
  labs(x = "miRNA", y = "Read count", 
       title = "Reads with miRBase+cnidarian database matches",
       fill = "Identified as miRNA?") +
  theme(axis.text.x = element_blank(),
        axis.ticks.x = element_blank())

ggsave("../output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/figures/Apul_ShortStack_dbmatch_histogram.png", width = 12, height = 7, units = "in")

There’s two miRNAs with very high read counts, and it’s making visualization of the rest difficult. Let’s remove them and retry visualizing the rest.

# Reads identified as miRNAs (but not necessarily known)
Apul_shortstack_results %>% 
  filter(MIRNA == "Y") %>%
  filter(Reads < 200000) %>%
  mutate(known_miRNAs = str_sub(known_miRNAs, 1, 40)) %>%
  mutate(Locus = str_sub(Locus, 20, 40)) %>%
  ggplot(aes(x = reorder(Locus, Reads), y = Reads, fill = known_miRNAs)) +
  geom_bar(stat = "identity") +
   geom_text(aes(label = Reads), vjust = 0.5, hjust = 0, color = "black", size = 2.5, angle = 90) +
  labs(x = "miRNA", y = "Read count", 
       title = "Reads identified by ShortStack as miRNAs",
       fill = "Annotation") +
  theme(axis.text.x = element_blank(),
        axis.ticks.x = element_blank())

ggsave("../output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/figures/Apul_ShortStack_miRNA_histogram_reduced.png", width = 12, height = 7, units = "in")


# Reads matched in the reference db (but not necessarily identified as miRNA)
Apul_shortstack_results %>% 
  filter(!is.na(known_miRNAs)) %>%
  filter(Reads < 200000) %>%
  mutate(known_miRNAs = str_sub(known_miRNAs, 1, 40)) %>%
  mutate(Locus = str_sub(Locus, 20, 40)) %>%
  ggplot(aes(x = reorder(Locus, Reads), y = Reads, fill = MIRNA)) +
  geom_bar(stat = "identity") +
  geom_text(aes(label = Reads), vjust = 0.5, hjust = 0, color = "black", size = 2.5, angle = 90) +
  labs(x = "miRNA", y = "Read count", 
       title = "Reads with miRBase+cnidarian database matches",
       fill = "Identified as miRNA?") +
  theme(axis.text.x = element_blank(),
        axis.ticks.x = element_blank())

ggsave("../output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/figures/Apul_ShortStack_dbmatch_histogram_reduced.png", width = 12, height = 7, units = "in")

# Make list
mirnas <- Apul_shortstack_results %>% filter(MIRNA == "Y") %>% pull(Locus)
matches <- Apul_shortstack_results %>% filter(!is.na(known_miRNAs)) %>% pull(Locus)

Apul_shortstack_vennlist <- list(
  "Identified as miRNA" = mirnas,
  "Database match" = matches
)

# Make venn diagrams
ggvenn(Apul_shortstack_vennlist)

ggsave("../output/11-Apul-sRNA-ShortStack_4.1.0-pulchra_genome/figures/Apul_ShortStack_venn.png", width = 12, height = 7, units = "in")

---

Citations

Axtell, Michael J. 2013. “ShortStack: Comprehensive Annotation and Quantification of Small RNA Genes.” RNA 19 (6): 740–51. https://doi.org/10.1261/rna.035279.112.

Johnson, Nathan R, Jonathan M Yeoh, Ceyda Coruh, and Michael J Axtell. 2016. “Improved Placement of Multi-Mapping Small RNAs.” G3 Genes|Genomes|Genetics 6 (7): 2103–11. https://doi.org/10.1534/g3.116.030452.

Shahid, Saima, and Michael J. Axtell. 2014. “Identification and Annotation of Small RNA Genes Using ShortStack.” Methods 67 (1): 20–27. https://doi.org/10.1016/j.ymeth.2013.10.004.