Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/srlab/programs/samtools-1.20/samtools' Reference genome folder provided is ../../data/genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/)' FastQ format assumed (by default) Attention: early reports suggested that high values of -p to have diminishing returns. Please test different values using a small subset of data for your hardware setting. Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/05-bismark-align-full'): ../../data/CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz ../../data/CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/05-bismark-align-full/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/05-bismark-align-full Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../../data/CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz Input files are in FastQ format Writing a C -> T converted version of the input file CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz to CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz to CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz (32085370 sequences in total) Writing a C -> T converted version of the input file CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz to CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz to CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz (32085370 sequences in total) Input files are CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ with the specified options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:25491:1047_1:N:0:TTATAACC+TCGATATC/1 77 * 0 0 * * 0 0 ANATTATATTAATATAAAAAAAAATAAAATATTAATTATATTATTAATTAATTTAATTTTATAAAAAAATATAAAATTTAAATTAATAAATTTTATTTATAGG F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:25491:1047_2:N:0:TTATAACC+TCGATATC/2 141 * 0 0 * * 0 0 CCTATAAATAAAATTTATTAATTTAAATTTTATATTTTTTTATAAAATTAAATTAATTAATAATATAATTAATATTTTATTTTTTTTTATATTAATATAATAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:25491:1047_1:N:0:TTATAACC+TCGATATC/1 77 * 0 0 * * 0 0 ANACCATACTAACACAAAAAAAAACAAAATACCAATCATACCACCAACTAACTTAACTCCACAAAAAAACATAAAATTCAAATCAACAAATTTCATCCACAAA F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:25491:1047_2:N:0:TTATAACC+TCGATATC/2 141 * 0 0 * * 0 0 TTTGTGGATGAAATTTGTTGATTTGAATTTTATGTTTTTTTGTGGAGTTAAGTTAGTTGGTGGTATGATTGGTATTTTGTTTTTTTTTGTGTTAGTATGGTGT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:25491:1047_1:N:0:TTATAACC+TCGATATC/1 77 * 0 0 * * 0 0 ANACCATACTAACACAAAAAAAAACAAAATACCAATCATACCACCAACTAACTTAACTCCACAAAAAAACATAAAATTCAAATCAACAAATTTCATCCACAAA F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:25491:1047_2:N:0:TTATAACC+TCGATATC/2 141 * 0 0 * * 0 0 TTTGTGGATGAAATTTGTTGATTTGAATTTTATGTTTTTTTGTGGAGTTAAGTTAGTTGGTGGTATGATTGGTATTTTGTTTTTTTTTGTGTTAGTATGGTGT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:25491:1047_1:N:0:TTATAACC+TCGATATC/1 77 * 0 0 * * 0 0 ANATTATATTAATATAAAAAAAAATAAAATATTAATTATATTATTAATTAATTTAATTTTATAAAAAAATATAAAATTTAAATTAATAAATTTTATTTATAGG F#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:25491:1047_2:N:0:TTATAACC+TCGATATC/2 141 * 0 0 * * 0 0 CCTATAAATAAAATTTATTAATTTAAATTTTATATTTTTTTATAAAATTAAATTAATTAATAATATAATTAATATTTTATTTTTTTTTATATTAATATAATAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFF YT:Z:UP >>> Writing bisulfite mapping results to CF01-CM01-Zygote_pe.bam <<< Reading in the sequence files ../../data/CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz Processed 1000000 sequence pairs so far Processed 2000000 sequence pairs so far Processed 3000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1235:8965:13917_1:N:0:TTATAACC+TCGATATC NC_007175.2 17178 Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1235:7202:14121_1:N:0:TTATAACC+TCGATATC NC_007175.2 17178 Processed 4000000 sequence pairs so far Processed 5000000 sequence pairs so far Processed 6000000 sequence pairs so far Processed 7000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1365:12572:4570_1:N:0:TTATAACC+TCGATATC NC_035780.1 2 Processed 8000000 sequence pairs so far Processed 9000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1452:24433:1470_1:N:0:TTATAACC+TCGATATC NC_007175.2 17176 Processed 10000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1469:23077:5008_1:N:0:TTATAACC+TCGATATC NC_007175.2 17108 Processed 11000000 sequence pairs so far Processed 12000000 sequence pairs so far Processed 13000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1575:21323:5729_1:N:0:TTATAACC+TCGATATC NC_007175.2 17171 Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:1575:22146:6089_1:N:0:TTATAACC+TCGATATC NC_007175.2 17171 Processed 14000000 sequence pairs so far Processed 15000000 sequence pairs so far Processed 16000000 sequence pairs so far Processed 17000000 sequence pairs so far Processed 18000000 sequence pairs so far Processed 19000000 sequence pairs so far Processed 20000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:2234:2311:34679_1:N:0:TTATAACC+TCGATATC NC_035780.1 1 Processed 21000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:2305:7446:31767_1:N:0:TTATAACC+TCGATATC NC_035780.1 1 Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:2305:5032:32471_1:N:0:TTATAACC+TCGATATC NC_035780.1 1 Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:2305:5150:32487_1:N:0:TTATAACC+TCGATATC NC_035780.1 1 Processed 22000000 sequence pairs so far Processed 23000000 sequence pairs so far Processed 24000000 sequence pairs so far Processed 25000000 sequence pairs so far Processed 26000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:2464:3477:6324_1:N:0:TTATAACC+TCGATATC NC_007175.2 17116 Processed 27000000 sequence pairs so far Processed 28000000 sequence pairs so far Processed 29000000 sequence pairs so far Processed 30000000 sequence pairs so far Processed 31000000 sequence pairs so far Processed 32000000 sequence pairs so far Chromosomal sequence could not be extracted for GWNJ-1012:512:GW210315000:4:2677:24551:8844_1:N:0:TTATAACC+TCGATATC NC_007175.2 17176 32085370 reads; of these: 32085370 (100.00%) were paired; of these: 29146702 (90.84%) aligned concordantly 0 times 1283555 (4.00%) aligned concordantly exactly 1 time 1655113 (5.16%) aligned concordantly >1 times 9.16% overall alignment rate 32085370 reads; of these: 32085370 (100.00%) were paired; of these: 29506085 (91.96%) aligned concordantly 0 times 1119323 (3.49%) aligned concordantly exactly 1 time 1459962 (4.55%) aligned concordantly >1 times 8.04% overall alignment rate 32085370 reads; of these: 32085370 (100.00%) were paired; of these: 29516094 (91.99%) aligned concordantly 0 times 1112328 (3.47%) aligned concordantly exactly 1 time 1456948 (4.54%) aligned concordantly >1 times 8.01% overall alignment rate 32085370 reads; of these: 32085370 (100.00%) were paired; of these: 29157175 (90.87%) aligned concordantly 0 times 1276863 (3.98%) aligned concordantly exactly 1 time 1651332 (5.15%) aligned concordantly >1 times 9.13% overall alignment rate Processed 32085370 sequences in total Successfully deleted the temporary files CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, CF01-CM01-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF01-CM01-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 32085370 Final Cytosine Methylation Report ================================= Total number of C's analysed: 147756270 Total methylated C's in CpG context: 3133060 Total methylated C's in CHG context: 761746 Total methylated C's in CHH context: 5081089 Total methylated C's in Unknown context: 323668 Total unmethylated C's in CpG context: 15103667 Total unmethylated C's in CHG context: 26035662 Total unmethylated C's in CHH context: 97641046 Total unmethylated C's in Unknown context: 1696327 C methylated in CpG context: 17.2% C methylated in CHG context: 2.8% C methylated in CHH context: 4.9% C methylated in Unknown context (CN or CHN): 16.0% Bismark completed in 0d 1h 21m 24s ==================== Bismark run complete ====================