Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/srlab/programs/samtools-1.20/samtools' Reference genome folder provided is ../../data/genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: early reports suggested that high values of -p to have diminishing returns. Please test different values using a small subset of data for your hardware setting. Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04.2-bismark-align'): ../../data/EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz ../../data/EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04.2-bismark-align/EF04-EM04-Zygote_score_L0-0.8/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04.2-bismark-align Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../../data/EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../../data/EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz Writing a C -> T converted version of the input file EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz to EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz to EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from ../../data/EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz Writing a C -> T converted version of the input file EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz to EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz to EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz (10001 sequences in total) Input files are EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ with the specified options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:27010:1047_1:N:0:CAAGCTAG+CGCTATGT/1 77 * 0 0 * * 0 0 TNTTGTTTTTTTGATTTGATTAATATTAAATTTTTATAAAATATTATATT F#FFFFF::FFFFFFF,:FFFFF:FF:FFF,,,FFFFFFFFFF,FFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:27010:1047_2:N:0:CAAGCTAG+CGCTATGT/2 141 * 0 0 * * 0 0 AATATAATATTTTATAAAAATTTAATATTAATCAAATCAAAAAAACAAAA FFF,F:FFFFFFFF:,FFFFF,FFFFFFFFFF:FFFFFF:FF,FF:FFF: YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:27010:1047_1:N:0:CAAGCTAG+CGCTATGT/1 77 * 0 0 * * 0 0 CNCTACTCTTCCAATCTAATCAATATTAAATTTCCACAAAACACTACACC F#FFFFF::FFFFFFF,:FFFFF:FF:FFF,,,FFFFFFFFFF,FFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:27010:1047_2:N:0:CAAGCTAG+CGCTATGT/2 141 * 0 0 * * 0 0 GGTGTAGTGTTTTGTGGAAATTTAATATTGATTAGATTGGAAGAGTAGGG FFF,F:FFFFFFFF:,FFFFF,FFFFFFFFFF:FFFFFF:FF,FF:FFF: YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:27010:1047_1:N:0:CAAGCTAG+CGCTATGT/1 77 * 0 0 * * 0 0 CNCTACTCTTCCAATCTAATCAATATTAAATTTCCACAAAACACTACACC F#FFFFF::FFFFFFF,:FFFFF:FF:FFF,,,FFFFFFFFFF,FFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:27010:1047_2:N:0:CAAGCTAG+CGCTATGT/2 141 * 0 0 * * 0 0 GGTGTAGTGTTTTGTGGAAATTTAATATTGATTAGATTGGAAGAGTAGGG FFF,F:FFFFFFFF:,FFFFF,FFFFFFFFFF:FFFFFF:FF,FF:FFF: YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.8 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:27010:1047_1:N:0:CAAGCTAG+CGCTATGT/1 77 * 0 0 * * 0 0 TNTTGTTTTTTTGATTTGATTAATATTAAATTTTTATAAAATATTATATT F#FFFFF::FFFFFFF,:FFFFF:FF:FFF,,,FFFFFFFFFF,FFFFFF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:27010:1047_2:N:0:CAAGCTAG+CGCTATGT/2 141 * 0 0 * * 0 0 AATATAATATTTTATAAAAATTTAATATTAATCAAATCAAAAAAACAAAA FFF,F:FFFFFFFF:,FFFFF,FFFFFFFFFF:FFFFFF:FF,FF:FFF: YT:Z:UP >>> Writing bisulfite mapping results to EF04-EM04-Zygote_L0-0.8_pe.bam <<< Reading in the sequence files ../../data/EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 9284 (92.84%) aligned concordantly 0 times 327 (3.27%10000) aligned concordantly exactly 1 time reads; of these: 38910000 ( (3.89%) aligned concordantly >1 times10000 100.00 reads; of these:7.16% %) were paired; of these: overall alignment rate 10000 (9295 (100.0092.95%%) were paired; of these:) aligned concordantly 0 times 9280323 ( (92.803.23%%) aligned concordantly 0 times) aligned concordantly exactly 1 time 323382 ( (3.233.82%%) aligned concordantly exactly 1 time) aligned concordantly >1 times 7.05397% ( overall alignment rate3.97 %) aligned concordantly >1 times 7.20% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 9310 (93.10%) aligned concordantly 0 times 325 (3.25%) aligned concordantly exactly 1 time 365 (3.65%) aligned concordantly >1 times 6.90% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, EF04-EM04-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and EF04-EM04-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 34489 Total methylated C's in CpG context: 781 Total methylated C's in CHG context: 374 Total methylated C's in CHH context: 1872 Total methylated C's in Unknown context: 188 Total unmethylated C's in CpG context: 3864 Total unmethylated C's in CHG context: 6071 Total unmethylated C's in CHH context: 21527 Total unmethylated C's in Unknown context: 563 C methylated in CpG context: 16.8% C methylated in CHG context: 5.8% C methylated in CHH context: 8.0% C methylated in Unknown context (CN or CHN): 25.0% Bismark completed in 0d 0h 0m 22s ==================== Bismark run complete ====================