Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/srlab/programs/samtools-1.20/samtools' Reference genome folder provided is ../../data/genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: early reports suggested that high values of -p to have diminishing returns. Please test different values using a small subset of data for your hardware setting. Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04.2-bismark-align'): ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04.2-bismark-align/CF08-CM03-Zygote_score_L0-1.0/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04.2-bismark-align Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz Writing a C -> T converted version of the input file CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz Writing a C -> T converted version of the input file CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz (10001 sequences in total) Input files are CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ with the specified options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 GNGTAGTTTATTATGATGGAATAGGTTAATGTAGGAATGTGTGTAGTTTGTTGGT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ACCAACAAACTACACACATTCCTACATTAACCTATTCCATCATAATAAACTACCC FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 ANATAATTTATTATAATAAAATAAATTAATATAAAAATATATATAATTTATTAAT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ATTAATAAATTATATATATTTTTATATTAATTTATTTTATTATAATAAATTATTT FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 ANATAATTTATTATAATAAAATAAATTAATATAAAAATATATATAATTTATTAAT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ATTAATAAATTATATATATTTTTATATTAATTTATTTTATTATAATAAATTATTT FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-1.0 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 GNGTAGTTTATTATGATGGAATAGGTTAATGTAGGAATGTGTGTAGTTTGTTGGT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ACCAACAAACTACACACATTCCTACATTAACCTATTCCATCATAATAAACTACCC FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP >>> Writing bisulfite mapping results to CF08-CM03-Zygote_L0-1.0_pe.bam <<< Reading in the sequence files ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8439 (84.39%) aligned concordantly 0 times 673 (6.73%) aligned concordantly exactly 1 time 888 (8.88%) aligned concordantly >1 times 15.61% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8512 (85.12%) aligned concordantly 0 times 608 (6.08%) aligned concordantly exactly 1 time 880 (8.80%) aligned concordantly >1 times 14.88% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8144 (81.44%) aligned concordantly 0 times 731 (7.31%) aligned concordantly exactly 1 time 1125 (11.25%) aligned concordantly >1 times 18.56% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8186 (81.86%) aligned concordantly 0 times 713 (7.13%) aligned concordantly exactly 1 time 1101 (11.01%) aligned concordantly >1 times 18.14% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 70468 Total methylated C's in CpG context: 1400 Total methylated C's in CHG context: 580 Total methylated C's in CHH context: 4936 Total methylated C's in Unknown context: 259 Total unmethylated C's in CpG context: 6578 Total unmethylated C's in CHG context: 11617 Total unmethylated C's in CHH context: 45357 Total unmethylated C's in Unknown context: 1170 C methylated in CpG context: 17.5% C methylated in CHG context: 4.8% C methylated in CHH context: 9.8% C methylated in Unknown context (CN or CHN): 18.1% Bismark completed in 0d 0h 0m 15s ==================== Bismark run complete ====================