Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.5.4]) Output format is BAM (default) Alignments will be written out in BAM format. Samtools found here: '/srlab/programs/samtools-1.20/samtools' Reference genome folder provided is ../../data/genome/ (absolute path is '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/)' FastQ format assumed (by default) Processing sequences up to read no. 10000 from the input file Attention: early reports suggested that high values of -p to have diminishing returns. Please test different values using a small subset of data for your hardware setting. Each Bowtie 2 instance is going to be run with 8 threads. Please monitor performance closely and tune down if necessary! Input files to be analysed (in current folder '/mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04-bismark-align'): ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz Library was specified to be not strand-specific (non-directional), therefore alignments to all four possible bisulfite strands (OT, CTOT, OB and CTOB) will be reported Output will be written into the directory: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04-bismark-align/ Setting parallelization to single-threaded (default) Summary of all aligner options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Current working directory is: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/output/04-bismark-align Now reading in and storing sequence information of the genome specified in: /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ Single-core mode: setting pid to 1 Paired-end alignments will be performed ======================================= The provided filenames for paired-end alignments are ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz Input files are in FastQ format Processing reads up to sequence no. 10000 from ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz Writing a C -> T converted version of the input file CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz (10001 sequences in total) Processing reads up to sequence no. 10000 from ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz Writing a C -> T converted version of the input file CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq Writing a G -> A converted version of the input file CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz to CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Created C -> T as well as G -> A converted versions of the FastQ file CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz (10001 sequences in total) Input files are CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq (FastQ) Now running 4 individual instances of Bowtie 2 against the bisulfite genome of /mmfs1/gscratch/scrubbed/sr320/github/ceasmallr/data/genome/ with the specified options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 GNGTAGTTTATTATGATGGAATAGGTTAATGTAGGAATGTGTGTAGTTTGTTGGT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ACCAACAAACTACACACATTCCTACATTAACCTATTCCATCATAATAAACTACCC FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2GAgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 ANATAATTTATTATAATAAAATAAATTAATATAAAAATATATATAATTTATTAAT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ATTAATAAATTATATATATTTTTATATTAATTTATTTTATTATAATAAATTATTT FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for GAread1CTread2CTgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 ANATAATTTATTATAATAAAATAAATTAATATAAAAATATATATAATTTATTAAT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ATTAATAAATTATATATATTTTTATATTAATTTATTTTATTATAATAAATTATTT FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, with the options: -q --score-min L,0,-0.6 -p 8 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw)) Found first alignment: GWNJ-1012:512:GW210315000:4:1101:28619:1047_1:N:0:GACCTGAA+CTCACCAA/1 77 * 0 0 * * 0 0 GNGTAGTTTATTATGATGGAATAGGTTAATGTAGGAATGTGTGTAGTTTGTTGGT F#F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FF YT:Z:UP GWNJ-1012:512:GW210315000:4:1101:28619:1047_2:N:0:GACCTGAA+CTCACCAA/2 141 * 0 0 * * 0 0 ACCAACAAACTACACACATTCCTACATTAACCTATTCCATCATAATAAACTACCC FFFFFFFFFFFFFFFFFFFFFFFFF:::FFFFFFFFFF:FFFFFFFFFFFFFFFF YT:Z:UP >>> Writing bisulfite mapping results to CF08-CM03-Zygote_pe.bam <<< Reading in the sequence files ../../data/CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz and ../../data/CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz 10000 reads; of these: 10000 (100.00%) were paired; of these: 8861 (88.61%) aligned concordantly 0 times 514 (5.14%) aligned concordantly exactly 1 time 625 (6.25%) aligned concordantly >1 times 11.39% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 100009206 reads; of these: ( 92.06 %10000) aligned concordantly 0 times ( 100.00351% () were paired; of these:3.51 % ) aligned concordantly exactly 1 time9147 ( 91.47443% () aligned concordantly 0 times4.43 % ) aligned concordantly >1 times405 (7.944.05%% overall alignment rate) aligned concordantly exactly 1 time 448 (4.48%) aligned concordantly >1 times 8.53% overall alignment rate 10000 reads; of these: 10000 (100.00%) were paired; of these: 8842 (88.42%) aligned concordantly 0 times 535 (5.35%) aligned concordantly exactly 1 time 623 (6.23%) aligned concordantly >1 times 11.58% overall alignment rate Processed 10000 sequences in total Successfully deleted the temporary files CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_C_to_T.fastq, CF08-CM03-Zygote_R1_001.fastp-trim.20220827.fq.gz_G_to_A.fastq, CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_C_to_T.fastq and CF08-CM03-Zygote_R2_001.fastp-trim.20220827.fq.gz_G_to_A.fastq Final Alignment report ====================== Sequence pairs analysed in total: 10000 Final Cytosine Methylation Report ================================= Total number of C's analysed: 47765 Total methylated C's in CpG context: 1048 Total methylated C's in CHG context: 345 Total methylated C's in CHH context: 2130 Total methylated C's in Unknown context: 45 Total unmethylated C's in CpG context: 4516 Total unmethylated C's in CHG context: 8440 Total unmethylated C's in CHH context: 31286 Total unmethylated C's in Unknown context: 367 C methylated in CpG context: 18.8% C methylated in CHG context: 3.9% C methylated in CHH context: 6.4% C methylated in Unknown context (CN or CHN): 10.9% Bismark completed in 0d 0h 0m 20s ==================== Bismark run complete ====================