01-blast

Author

Kathleen Durkin

Published

April 2, 2025

Download blast

NOTE: I only need to download blast using the below code if I’m working in Jupyter. When working in Raven I can use blast as already available in /home/shared

I am going to download blast and use it to compare unknown sequences

cd /home/jovyan/applications
curl -O https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/ncbi-blast-2.16.0+-x64-linux.tar.gz
tar -xf ncbi-blast-2.16.0+-x64-linux.tar.gz
# If working in Jupyter:
#/home/jovyan/applications/ncbi-blast-2.16.0+/bin/blastx -h

# If working in Raven:
/home/shared/ncbi-blast-2.15.0+/bin/blastx -h
USAGE
  blastx [-h] [-help] [-import_search_strategy filename]
    [-export_search_strategy filename] [-task task_name] [-db database_name]
    [-dbsize num_letters] [-gilist filename] [-seqidlist filename]
    [-negative_gilist filename] [-negative_seqidlist filename]
    [-taxids taxids] [-negative_taxids taxids] [-taxidlist filename]
    [-negative_taxidlist filename] [-no_taxid_expansion] [-ipglist filename]
    [-negative_ipglist filename] [-entrez_query entrez_query]
    [-db_soft_mask filtering_algorithm] [-db_hard_mask filtering_algorithm]
    [-subject subject_input_file] [-subject_loc range] [-query input_file]
    [-out output_file] [-evalue evalue] [-word_size int_value]
    [-gapopen open_penalty] [-gapextend extend_penalty]
    [-qcov_hsp_perc float_value] [-max_hsps int_value]
    [-xdrop_ungap float_value] [-xdrop_gap float_value]
    [-xdrop_gap_final float_value] [-searchsp int_value]
    [-sum_stats bool_value] [-max_intron_length length] [-seg SEG_options]
    [-soft_masking soft_masking] [-matrix matrix_name]
    [-threshold float_value] [-culling_limit int_value]
    [-best_hit_overhang float_value] [-best_hit_score_edge float_value]
    [-subject_besthit] [-window_size int_value] [-ungapped] [-lcase_masking]
    [-query_loc range] [-strand strand] [-parse_deflines]
    [-query_gencode int_value] [-outfmt format] [-show_gis]
    [-num_descriptions int_value] [-num_alignments int_value]
    [-line_length line_length] [-html] [-sorthits sort_hits]
    [-sorthsps sort_hsps] [-max_target_seqs num_sequences]
    [-num_threads int_value] [-mt_mode int_value] [-remote]
    [-comp_based_stats compo] [-use_sw_tback] [-version]

DESCRIPTION
   Translated Query-Protein Subject BLAST 2.15.0+

Use '-help' to print detailed descriptions of command line arguments

Download Uniprot/Swissprot reference fastas

see https://www.uniprot.org/downloads

https://ftp.uniprot.org/pub/databases/uniprot/current_release/knowledgebase/complete/uniprot_sprot.fasta.gz

cd ../data
curl -O https://ftp.uniprot.org/pub/databases/uniprot/current_release/knowledgebase/complete/uniprot_sprot.fasta.gz
mv uniprot_sprot.fasta.gz uniprot_sprot_r2025_04_03.fasta.gz
gunzip -k uniprot_sprot_r2025_04_03.fasta.gz
ls ../data

Build BLAST db

# If working in Jupytr Hub, file path is:
# /home/jovyan/applications/ncbi-blast-2.16.0+/bin

/home/shared/ncbi-blast-2.15.0+/bin/makeblastdb \
-in ../data/uniprot_sprot_r2025_04_03.fasta \
-dbtype prot \
-out ../output/01-blast/blastdb/uniprot_sprot_r2025_04_03


Building a new DB, current time: 04/03/2025 15:01:50
New DB name:   /home/shared/8TB_HDD_02/shedurkin/kathleen-coral/assignments/output/01-blast/blastdb/uniprot_sprot_r2025_04_03
New DB title:  ../data/uniprot_sprot_r2025_04_03.fasta
Sequence type: Protein
Deleted existing Protein BLAST database named /home/shared/8TB_HDD_02/shedurkin/kathleen-coral/assignments/output/01-blast/blastdb/uniprot_sprot_r2025_04_03
Keep MBits: T
Maximum file size: 3000000000B
Adding sequences from FASTA; added 572970 sequences in 8.61971 seconds.

Get the query sequence

curl https://eagle.fish.washington.edu/cnidarian/Ab_4denovo_CLC6_a.fa \
-k \
> ../data/Ab_4denovo_CLC6_a.fa
  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed

  0     0    0     0    0     0      0      0 --:--:-- --:--:-- --:--:--     0
100 1982k  100 1982k    0     0  5648k      0 --:--:-- --:--:-- --:--:-- 5648k

Check

head ../data/Ab_4denovo_CLC6_a.fa
echo "How many sequences are there?"
grep -c ">" ../data/Ab_4denovo_CLC6_a.fa
>solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed_contig_1
ACACCCCACCCCAACGCACCCTCACCCCCACCCCAACAATCCATGATTGAATACTTCATC
TATCCAAGACAAACTCCTCCTACAATCCATGATAGAATTCCTCCAAAAATAATTTCACAC
TGAAACTCCGGTATCCGAGTTATTTTGTTCCCAGTAAAATGGCATCAACAAAAGTAGGTC
TGGATTAACGAACCAATGTTGCTGCGTAATATCCCATTGACATATCTTGTCGATTCCTAC
CAGGATCCGGACTGACGAGATTTCACTGTACGTTTATGCAAGTCATTTCCATATATAAAA
TTGGATCTTATTTGCACAGTTAAATGTCTCTATGCTTATTTATAAATCAATGCCCGTAAG
CTCCTAATATTTCTCTTTTCGTCCGACGAGCAAACAGTGAGTTTACTGTGGCCTTCAGCA
AAAGTATTGATGTTGTAAATCTCAGTTGTGATTGAACAATTTGCCTCACTAGAAGTAGCC
TTC
How many sequences are there?
5490

Run BLAST

/home/shared/ncbi-blast-2.15.0+/bin/blastx \
-query ../data/Ab_4denovo_CLC6_a.fa \
-db ../output/01-blast/blastdb/uniprot_sprot_r2025_04_03 \
-out ../output/01-blast/Ab_4-uniprot_blastx.tab \
-evalue 1E-20 \
-num_threads 20 \
-max_target_seqs 1 \
-outfmt 6
Warning: [blastx] Examining 5 or more matches is recommended
Warning: [Query 1-27] Examining 5 or more matches is recommended
Warning: [Query 28-57] Examining 5 or more matches is recommended
Warning: [Query 58-87] Examining 5 or more matches is recommended
Warning: [Query 88-116] Examining 5 or more matches is recommended
Warning: [Query 117-147] Examining 5 or more matches is recommended
Warning: [Query 148-179] Examining 5 or more matches is recommended
Warning: [Query 180-213] Examining 5 or more matches is recommended
Warning: [Query 214-237] Examining 5 or more matches is recommended
Warning: [Query 238-267] Examining 5 or more matches is recommended
Warning: [Query 268-296] Examining 5 or more matches is recommended
Warning: [Query 297-319] Examining 5 or more matches is recommended
Warning: [Query 320-348] Examining 5 or more matches is recommended
Warning: [Query 349-381] Examining 5 or more matches is recommended
Warning: [Query 382-411] Examining 5 or more matches is recommended
Warning: [Query 412-441] Examining 5 or more matches is recommended
Warning: [Query 442-468] Examining 5 or more matches is recommended
Warning: [Query 469-498] Examining 5 or more matches is recommended
Warning: [Query 499-528] Examining 5 or more matches is recommended
Warning: [Query 529-554] Examining 5 or more matches is recommended
Warning: [Query 555-585] Examining 5 or more matches is recommended
Warning: [Query 586-617] Examining 5 or more matches is recommended
Warning: [Query 618-645] Examining 5 or more matches is recommended
Warning: [Query 646-668] Examining 5 or more matches is recommended
Warning: [Query 669-700] Examining 5 or more matches is recommended
Warning: [Query 701-734] Examining 5 or more matches is recommended
Warning: [Query 735-764] Examining 5 or more matches is recommended
Warning: [Query 765-797] Examining 5 or more matches is recommended
Warning: [Query 798-822] Examining 5 or more matches is recommended
Warning: [Query 823-853] Examining 5 or more matches is recommended
Warning: [Query 854-881] Examining 5 or more matches is recommended
Warning: [Query 882-912] Examining 5 or more matches is recommended
Warning: [Query 913-942] Examining 5 or more matches is recommended
Warning: [Query 943-970] Examining 5 or more matches is recommended
Warning: [Query 971-1003] Examining 5 or more matches is recommended
Warning: [Query 1004-1033] Examining 5 or more matches is recommended
Warning: [Query 1034-1061] Examining 5 or more matches is recommended
Warning: [Query 1062-1091] Examining 5 or more matches is recommended
Warning: [Query 1092-1123] Examining 5 or more matches is recommended
Warning: [Query 1124-1156] Examining 5 or more matches is recommended
Warning: [Query 1157-1192] Examining 5 or more matches is recommended
Warning: [Query 1193-1221] Examining 5 or more matches is recommended
Warning: [Query 1222-1250] Examining 5 or more matches is recommended
Warning: [Query 1251-1282] Examining 5 or more matches is recommended
Warning: [Query 1283-1314] Examining 5 or more matches is recommended
Warning: [Query 1315-1347] Examining 5 or more matches is recommended
Warning: [Query 1348-1381] Examining 5 or more matches is recommended
Warning: [Query 1382-1414] Examining 5 or more matches is recommended
Warning: [Query 1415-1445] Examining 5 or more matches is recommended
Warning: [Query 1446-1478] Examining 5 or more matches is recommended
Warning: [Query 1479-1507] Examining 5 or more matches is recommended
Warning: [Query 1508-1540] Examining 5 or more matches is recommended
Warning: [Query 1541-1571] Examining 5 or more matches is recommended
Warning: [Query 1572-1605] Examining 5 or more matches is recommended
Warning: [Query 1606-1637] Examining 5 or more matches is recommended
Warning: [Query 1638-1670] Examining 5 or more matches is recommended
Warning: [Query 1671-1702] Examining 5 or more matches is recommended
Warning: [Query 1703-1737] Examining 5 or more matches is recommended
Warning: [Query 1738-1768] Examining 5 or more matches is recommended
Warning: [Query 1769-1800] Examining 5 or more matches is recommended
Warning: [Query 1801-1832] Examining 5 or more matches is recommended
Warning: [Query 1833-1869] Examining 5 or more matches is recommended
Warning: [Query 1870-1902] Examining 5 or more matches is recommended
Warning: [Query 1903-1938] Examining 5 or more matches is recommended
Warning: [Query 1939-1973] Examining 5 or more matches is recommended
Warning: [Query 1974-2005] Examining 5 or more matches is recommended
Warning: [Query 2006-2042] Examining 5 or more matches is recommended
Warning: [Query 2043-2074] Examining 5 or more matches is recommended
Warning: [Query 2075-2103] Examining 5 or more matches is recommended
Warning: [Query 2104-2137] Examining 5 or more matches is recommended
Warning: [Query 2138-2170] Examining 5 or more matches is recommended
Warning: [Query 2171-2202] Examining 5 or more matches is recommended
Warning: [Query 2203-2240] Examining 5 or more matches is recommended
Warning: [Query 2241-2272] Examining 5 or more matches is recommended
Warning: [Query 2273-2304] Examining 5 or more matches is recommended
Warning: [Query 2305-2337] Examining 5 or more matches is recommended
Warning: [Query 2338-2371] Examining 5 or more matches is recommended
Warning: [Query 2372-2404] Examining 5 or more matches is recommended
Warning: [Query 2405-2436] Examining 5 or more matches is recommended
Warning: [Query 2437-2468] Examining 5 or more matches is recommended
Warning: [Query 2469-2503] Examining 5 or more matches is recommended
Warning: [Query 2504-2538] Examining 5 or more matches is recommended
Warning: [Query 2539-2574] Examining 5 or more matches is recommended
Warning: [Query 2575-2609] Examining 5 or more matches is recommended
Warning: [Query 2610-2642] Examining 5 or more matches is recommended
Warning: [Query 2643-2678] Examining 5 or more matches is recommended
Warning: [Query 2679-2712] Examining 5 or more matches is recommended
Warning: [Query 2713-2747] Examining 5 or more matches is recommended
Warning: [Query 2748-2781] Examining 5 or more matches is recommended
Warning: [Query 2782-2816] Examining 5 or more matches is recommended
Warning: [Query 2817-2852] Examining 5 or more matches is recommended
Warning: [Query 2853-2890] Examining 5 or more matches is recommended
Warning: [Query 2891-2923] Examining 5 or more matches is recommended
Warning: [Query 2924-2956] Examining 5 or more matches is recommended
Warning: [Query 2957-2992] Examining 5 or more matches is recommended
Warning: [Query 2993-3029] Examining 5 or more matches is recommended
Warning: [Query 3030-3063] Examining 5 or more matches is recommended
Warning: [Query 3064-3098] Examining 5 or more matches is recommended
Warning: [Query 3099-3133] Examining 5 or more matches is recommended
Warning: [Query 3134-3170] Examining 5 or more matches is recommended
Warning: [Query 3171-3204] Examining 5 or more matches is recommended
Warning: [Query 3205-3240] Examining 5 or more matches is recommended
Warning: [Query 3241-3276] Examining 5 or more matches is recommended
Warning: [Query 3277-3316] Examining 5 or more matches is recommended
Warning: [Query 3317-3351] Examining 5 or more matches is recommended
Warning: [Query 3352-3389] Examining 5 or more matches is recommended
Warning: [Query 3390-3426] Examining 5 or more matches is recommended
Warning: [Query 3427-3463] Examining 5 or more matches is recommended
Warning: [Query 3464-3498] Examining 5 or more matches is recommended
Warning: [Query 3499-3533] Examining 5 or more matches is recommended
Warning: [Query 3534-3570] Examining 5 or more matches is recommended
Warning: [Query 3571-3609] Examining 5 or more matches is recommended
Warning: [Query 3610-3642] Examining 5 or more matches is recommended
Warning: [Query 3643-3678] Examining 5 or more matches is recommended
Warning: [Query 3679-3717] Examining 5 or more matches is recommended
Warning: [Query 3718-3754] Examining 5 or more matches is recommended
Warning: [Query 3755-3792] Examining 5 or more matches is recommended
Warning: [Query 3793-3832] Examining 5 or more matches is recommended
Warning: [Query 3833-3868] Examining 5 or more matches is recommended
Warning: [Query 3869-3908] Examining 5 or more matches is recommended
Warning: [Query 3909-3946] Examining 5 or more matches is recommended
Warning: [Query 3947-3982] Examining 5 or more matches is recommended
Warning: [Query 3983-4018] Examining 5 or more matches is recommended
Warning: [Query 4019-4054] Examining 5 or more matches is recommended
Warning: [Query 4055-4092] Examining 5 or more matches is recommended
Warning: [Query 4093-4131] Examining 5 or more matches is recommended
Warning: [Query 4132-4170] Examining 5 or more matches is recommended
Warning: [Query 4171-4208] Examining 5 or more matches is recommended
Warning: [Query 4209-4246] Examining 5 or more matches is recommended
Warning: [Query 4247-4288] Examining 5 or more matches is recommended
Warning: [Query 4289-4325] Examining 5 or more matches is recommended
Warning: [Query 4326-4363] Examining 5 or more matches is recommended
Warning: [Query 4364-4402] Examining 5 or more matches is recommended
Warning: [Query 4403-4441] Examining 5 or more matches is recommended
Warning: [Query 4442-4479] Examining 5 or more matches is recommended
Warning: [Query 4480-4518] Examining 5 or more matches is recommended
Warning: [Query 4519-4554] Examining 5 or more matches is recommended
Warning: [Query 4555-4593] Examining 5 or more matches is recommended
Warning: [Query 4594-4633] Examining 5 or more matches is recommended
Warning: [Query 4634-4671] Examining 5 or more matches is recommended
Warning: [Query 4672-4709] Examining 5 or more matches is recommended
Warning: [Query 4710-4748] Examining 5 or more matches is recommended
Warning: [Query 4749-4787] Examining 5 or more matches is recommended
Warning: [Query 4788-4828] Examining 5 or more matches is recommended
Warning: [Query 4829-4869] Examining 5 or more matches is recommended
Warning: [Query 4870-4905] Examining 5 or more matches is recommended
Warning: [Query 4906-4944] Examining 5 or more matches is recommended
Warning: [Query 4945-4983] Examining 5 or more matches is recommended
Warning: [Query 4984-5024] Examining 5 or more matches is recommended
Warning: [Query 5025-5065] Examining 5 or more matches is recommended
Warning: [Query 5066-5105] Examining 5 or more matches is recommended
Warning: [Query 5106-5147] Examining 5 or more matches is recommended
Warning: [Query 5148-5187] Examining 5 or more matches is recommended
Warning: [Query 5188-5229] Examining 5 or more matches is recommended
Warning: [Query 5230-5270] Examining 5 or more matches is recommended
Warning: [Query 5271-5311] Examining 5 or more matches is recommended
Warning: [Query 5312-5353] Examining 5 or more matches is recommended
Warning: [Query 5354-5393] Examining 5 or more matches is recommended
Warning: [Query 5394-5434] Examining 5 or more matches is recommended
Warning: [Query 5435-5475] Examining 5 or more matches is recommended
Warning: [Query 5476-5490] Examining 5 or more matches is recommended
head -2 ../output/01-blast/Ab_4-uniprot_blastx.tab
wc -l ../output/01-blast/Ab_4-uniprot_blastx.tab
solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed_contig_3    sp|O42248|GBLP_DANRE    82.456  171 30  0   1   513 35  205 2.83e-103   301
solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed_contig_5    sp|Q08013|SSRG_RAT  75.385  65  16  0   3   197 121 185 1.41e-28    104
765 ../output/01-blast/Ab_4-uniprot_blastx.tab

Download Uniprot/Swissprot reference table

Download

cd ../data
curl -o uniprot_table_r2025_04_03.tab -H "Accept: text/plain; format=tsv" "https://rest.uniprot.org/uniprotkb/stream?compressed=true&fields=accession%2Creviewed%2Cid%2Cprotein_name%2Cgene_names%2Corganism_name%2Clength%2Cgo_p%2Cgo%2Cgo_id%2Cgo_c%2Cgo_f&format=tsv&query=%28*%29+AND+%28reviewed%3Atrue%29"

mv "stream?compressed=true&fields=accession%2Creviewed%2Cid%2Cprotein_name%2Cgene_names%2Corganism_name%2Clength%2Cgo_p%2Cgo%2Cgo_id%2Cgo_c%2Cgo_f&format=tsv&query=%28*%29+AND+%28reviewed%3Atrue%29" uniprot_table_r2025_04_03.tab

Check file

head -2 ../data/uniprot_table_r2025_04_03.tab
wc -l ../data/uniprot_table_r2025_04_03.tab
<8b>
<ab><96><86>k<9c>4o<ed>2<df>x<eb><de><e1><ef>8<b3>^<f3><f3>g%G<fe><b3>.<9f><e7>e<ea>%/<d3>W<f3>2<8d>U<fb><d1> BhnZ]<af><c3>$<9a>wn.بٽ<ee>j<f3><cd>8\<ea><d1>r<92>4<d9><ab>y<ad>C@<f6>)<.<fa>e<80><a5><a5><d7>SjC<af>$<b3><97>V
248932 ../data/uniprot_table_r2025_04_03.tab

Join tables to functionally annotate sequences

Separate the sp|O42248|GBLP_DANRE portion into its individual components (so they can be used for searching/joining purposes)

tr '|' '\t' < ../output/01-blast/Ab_4-uniprot_blastx.tab | head -2
solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed_contig_3    sp  O42248  GBLP_DANRE  82.456  171 30  0   1   513 35  205 2.83e-103   301
solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed_contig_5    sp  Q08013  SSRG_RAT    75.385  65  16  0   3   197 121 185 1.41e-28    104

Save this as a new file

tr '|' '\t' < ../output/01-blast/Ab_4-uniprot_blastx.tab \
> ../output/01-blast/Ab_4-uniprot_blastx_sep.tab

Read blast results and Uniprot/Swissprot table into R and join

library(tidyverse)
── Attaching core tidyverse packages ──────────────────────── tidyverse 2.0.0 ──
✔ dplyr     1.1.4     ✔ readr     2.1.5
✔ forcats   1.0.0     ✔ stringr   1.5.1
✔ ggplot2   3.5.1     ✔ tibble    3.2.1
✔ lubridate 1.9.4     ✔ tidyr     1.3.1
✔ purrr     1.0.2     
── Conflicts ────────────────────────────────────────── tidyverse_conflicts() ──
✖ dplyr::filter() masks stats::filter()
✖ dplyr::lag()    masks stats::lag()
ℹ Use the conflicted package (<http://conflicted.r-lib.org/>) to force all conflicts to become errors
library(kableExtra)

Attaching package: 'kableExtra'

The following object is masked from 'package:dplyr':

    group_rows
# Load data
bltabl <- read.csv("../output/01-blast/Ab_4-uniprot_blastx_sep.tab", sep = '\t', header = FALSE)
spgo <- read.csv("../data/uniprot_table_r2025_04_03.tab", sep = '\t', header = TRUE)


kbl(
  head(
    left_join(bltabl, spgo,  by = c("V3" = "Entry")) %>%
    select(V1, V3, V13, Protein.names, Organism, Gene.Ontology..biological.process., Gene.Ontology.IDs) %>% mutate(V1 = str_replace_all(V1, 
              pattern = "solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed", replacement = "Ab"))
  )
) %>%
  kable_styling(bootstrap_options = c("striped", "hover", "condensed", "responsive"))
V1 V3 V13 Protein.names Organism Gene.Ontology..biological.process. Gene.Ontology.IDs
Ab_contig_3 O42248 0 Small ribosomal subunit protein RACK1 (Guanine nucleotide-binding protein subunit beta-2-like 1) (Receptor of activated protein kinase C) (RACK) Danio rerio (Zebrafish) (Brachydanio rerio) angiogenesis [GO:0001525]; convergent extension involved in gastrulation [GO:0060027]; negative regulation of translational frameshifting [GO:2001125]; negative regulation of Wnt signaling pathway [GO:0030178]; positive regulation of gastrulation [GO:2000543]; regulation of cell division [GO:0051302]; regulation of establishment of cell polarity [GO:2000114]; regulation of protein localization [GO:0032880]; rescue of stalled ribosome [GO:0072344] GO:0001525; GO:0005080; GO:0005634; GO:0005737; GO:0005829; GO:0005840; GO:0030178; GO:0032880; GO:0043022; GO:0045182; GO:0051302; GO:0060027; GO:0072344; GO:1990904; GO:2000114; GO:2000543; GO:2001125
Ab_contig_5 Q08013 0 Translocon-associated protein subunit gamma (TRAP-gamma) (Signal sequence receptor subunit gamma) (SSR-gamma) Rattus norvegicus (Rat) SRP-dependent cotranslational protein targeting to membrane [GO:0006614] GO:0005783; GO:0005784; GO:0006614
Ab_contig_6 P12234 0 Solute carrier family 25 member 3 (Phosphate carrier protein, mitochondrial) (PiC) (Phosphate transport protein) (PTP) Bos taurus (Bovine) mitochondrial phosphate ion transmembrane transport [GO:1990547]; phosphate ion transmembrane transport [GO:0035435] GO:0005315; GO:0005739; GO:0005743; GO:0015293; GO:0015317; GO:0035435; GO:0044877; GO:1990547
Ab_contig_9 Q41629 0 ADP,ATP carrier protein 1, mitochondrial (ADP/ATP translocase 1) (Adenine nucleotide translocator 1) (ANT 1) Triticum aestivum (Wheat) mitochondrial ADP transmembrane transport [GO:0140021]; mitochondrial ATP transmembrane transport [GO:1990544] GO:0005471; GO:0005743; GO:0140021; GO:1990544
Ab_contig_13 Q32NG4 0 Glutamine amidotransferase-like class 1 domain-containing protein 1 (Ferry endosomal RAB5 effector complex subunit 5) (Fy-5) (Parkinson disease 7 domain-containing protein 1) Xenopus laevis (African clawed frog) methylglyoxal catabolic process to D-lactate via S-lactoyl-glutathione [GO:0019243] GO:0005576; GO:0005769; GO:0019172; GO:0019243
Ab_contig_23 Q9GNE2 0 Large ribosomal subunit protein uL14 (60S ribosomal protein L23) (AeRpL17A) (L17A) Aedes aegypti (Yellowfever mosquito) (Culex aegypti) translation [GO:0006412] GO:0003735; GO:0006412; GO:0022625; GO:0070180
left_join(bltabl, spgo,  by = c("V3" = "Entry")) %>%
  select(V1, V3, V13, Protein.names, Organism, Gene.Ontology..biological.process., Gene.Ontology.IDs) %>% mutate(V1 = str_replace_all(V1, 
            pattern = "solid0078_20110412_FRAG_BC_WHITE_WHITE_F3_QV_SE_trimmed", replacement = "Ab")) %>%
  write_delim("../output/01-blast/blast_annot_go.tab", delim = '\t')